Incidental Mutation 'R0687:Tm7sf3'
ID61194
Institutional Source Beutler Lab
Gene Symbol Tm7sf3
Ensembl Gene ENSMUSG00000040234
Gene Nametransmembrane 7 superfamily member 3
Synonyms2010003B14Rik
MMRRC Submission 038872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0687 (G1)
Quality Score122
Status Not validated
Chromosome6
Chromosomal Location146602352-146642824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146621890 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 163 (N163I)
Ref Sequence ENSEMBL: ENSMUSP00000045650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037709] [ENSMUST00000127529]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037709
AA Change: N163I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045650
Gene: ENSMUSG00000040234
AA Change: N163I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DUF4203 291 498 8.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127529
SMART Domains Protein: ENSMUSP00000118517
Gene: ENSMUSG00000040234

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147027
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T G 7: 34,245,418 Q679P possibly damaging Het
Anxa10 T A 8: 62,092,572 D42V possibly damaging Het
B3gnt9 T A 8: 105,254,783 probably benign Het
Ccdc150 A T 1: 54,285,631 probably null Het
Fstl5 A G 3: 76,707,812 I727V possibly damaging Het
Nae1 C A 8: 104,513,244 R484L probably damaging Het
Nudt19 T A 7: 35,551,472 T281S probably benign Het
Osgin1 T A 8: 119,445,832 V455E probably damaging Het
Pcnx3 A T 19: 5,684,333 D655E probably damaging Het
Plch1 C T 3: 63,716,029 V617M probably damaging Het
Polk A T 13: 96,484,017 N579K probably damaging Het
Scube2 C A 7: 109,829,128 V513F possibly damaging Het
Skiv2l2 T C 13: 112,914,361 T227A probably damaging Het
Spen T C 4: 141,488,028 M498V unknown Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp24 A T 4: 106,420,504 K2277I probably damaging Het
Other mutations in Tm7sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tm7sf3 APN 6 146606194 missense possibly damaging 0.51
IGL01930:Tm7sf3 APN 6 146610933 missense possibly damaging 0.71
IGL02073:Tm7sf3 APN 6 146623710 missense possibly damaging 0.96
IGL02720:Tm7sf3 APN 6 146613374 splice site probably benign
IGL02815:Tm7sf3 APN 6 146613473 splice site probably null
IGL03255:Tm7sf3 APN 6 146606120 unclassified probably benign
R0245:Tm7sf3 UTSW 6 146618609 missense possibly damaging 0.53
R0402:Tm7sf3 UTSW 6 146606187 missense possibly damaging 0.95
R0763:Tm7sf3 UTSW 6 146606289 missense possibly damaging 0.93
R1419:Tm7sf3 UTSW 6 146603977 missense possibly damaging 0.71
R1511:Tm7sf3 UTSW 6 146609878 missense probably benign 0.05
R4880:Tm7sf3 UTSW 6 146609860 missense possibly damaging 0.93
R5930:Tm7sf3 UTSW 6 146603911 missense possibly damaging 0.53
R6160:Tm7sf3 UTSW 6 146606289 nonsense probably null
R6229:Tm7sf3 UTSW 6 146613389 missense possibly damaging 0.71
R6755:Tm7sf3 UTSW 6 146609973 splice site probably null
R6912:Tm7sf3 UTSW 6 146626103 missense possibly damaging 0.91
R6920:Tm7sf3 UTSW 6 146606147 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTCTAAGCTCACAGCAGGCTTACAC -3'
(R):5'- AGGGAACTGTACCCTTCTGACCTC -3'

Sequencing Primer
(F):5'- CCGTAAGCACTAAGGAGATTATTCAG -3'
(R):5'- TCAGTCACCGGACAGCAG -3'
Posted On2013-07-30