Incidental Mutation 'R0687:Nudt19'
List |< first << previous [record 7 of 17] next >> last >|
ID61196
Institutional Source Beutler Lab
Gene Symbol Nudt19
Ensembl Gene ENSMUSG00000034875
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 19
SynonymsD7Rp2-s, RP2-r, D7RP2e, RP2-s, androgen regulated gene RP2, D7Rp2-r, D7Rp2
MMRRC Submission 038872-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0687 (G1)
Quality Score168
Status Not validated
Chromosome7
Chromosomal Location35547185-35556304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35551472 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 281 (T281S)
Ref Sequence ENSEMBL: ENSMUSP00000047778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040962]
Predicted Effect probably benign
Transcript: ENSMUST00000040962
AA Change: T281S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047778
Gene: ENSMUSG00000034875
AA Change: T281S

DomainStartEndE-ValueType
Pfam:NUDIX 7 243 5.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181932
SMART Domains Protein: ENSMUSP00000138079
Gene: ENSMUSG00000097509

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 22 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T G 7: 34,245,418 Q679P possibly damaging Het
Anxa10 T A 8: 62,092,572 D42V possibly damaging Het
B3gnt9 T A 8: 105,254,783 probably benign Het
Ccdc150 A T 1: 54,285,631 probably null Het
Fstl5 A G 3: 76,707,812 I727V possibly damaging Het
Nae1 C A 8: 104,513,244 R484L probably damaging Het
Osgin1 T A 8: 119,445,832 V455E probably damaging Het
Pcnx3 A T 19: 5,684,333 D655E probably damaging Het
Plch1 C T 3: 63,716,029 V617M probably damaging Het
Polk A T 13: 96,484,017 N579K probably damaging Het
Scube2 C A 7: 109,829,128 V513F possibly damaging Het
Skiv2l2 T C 13: 112,914,361 T227A probably damaging Het
Spen T C 4: 141,488,028 M498V unknown Het
Tm7sf3 T A 6: 146,621,890 N163I possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp24 A T 4: 106,420,504 K2277I probably damaging Het
Other mutations in Nudt19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Nudt19 APN 7 35547911 makesense probably null
IGL01290:Nudt19 APN 7 35548076 missense probably damaging 1.00
R0194:Nudt19 UTSW 7 35551514 missense probably benign
R4802:Nudt19 UTSW 7 35556139 utr 5 prime probably benign
R5044:Nudt19 UTSW 7 35555746 missense possibly damaging 0.65
R5144:Nudt19 UTSW 7 35555225 missense probably benign
R5704:Nudt19 UTSW 7 35551547 missense probably benign
R5837:Nudt19 UTSW 7 35551636 missense possibly damaging 0.81
R6111:Nudt19 UTSW 7 35555527 missense probably benign 0.06
R8007:Nudt19 UTSW 7 35555620 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATCCCTCAAAACTTGTCAGGAAGC -3'
(R):5'- GTCCCCATCAGAGGCAACTGAATG -3'

Sequencing Primer
(F):5'- TCAAAACTTGTCAGGAAGCATAAGC -3'
(R):5'- CAGAGGCAACTGAATGTTTCC -3'
Posted On2013-07-30