Incidental Mutation 'R0687:Anxa10'
List |< first << previous [record 2 of 17] next >> last >|
ID61199
Institutional Source Beutler Lab
Gene Symbol Anxa10
Ensembl Gene ENSMUSG00000031635
Gene Nameannexin A10
Synonyms
MMRRC Submission 038872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0687 (G1)
Quality Score142
Status Not validated
Chromosome8
Chromosomal Location62057042-62123150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62092572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 42 (D42V)
Ref Sequence ENSEMBL: ENSMUSP00000034054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034052] [ENSMUST00000034054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034052
AA Change: D42V

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034052
Gene: ENSMUSG00000031635
AA Change: D42V

DomainStartEndE-ValueType
ANX 34 86 6.71e-16 SMART
ANX 106 158 8.13e-15 SMART
ANX 198 241 5.48e-2 SMART
ANX 264 316 6.51e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000034054
AA Change: D42V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034054
Gene: ENSMUSG00000031635
AA Change: D42V

DomainStartEndE-ValueType
ANX 34 86 6.71e-16 SMART
ANX 106 161 2.38e-1 SMART
ANX 178 221 5.48e-2 SMART
ANX 244 296 6.51e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210799
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. The function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Litter sizes from crosses of females that are either homozygous or heterozygous for a null allele contain fewer pups than wild-type females, indicating a dominant maternal effect on embryonic lethality. Embryos of homozygous null females die between E4.5 and E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T G 7: 34,245,418 Q679P possibly damaging Het
B3gnt9 T A 8: 105,254,783 probably benign Het
Ccdc150 A T 1: 54,285,631 probably null Het
Fstl5 A G 3: 76,707,812 I727V possibly damaging Het
Nae1 C A 8: 104,513,244 R484L probably damaging Het
Nudt19 T A 7: 35,551,472 T281S probably benign Het
Osgin1 T A 8: 119,445,832 V455E probably damaging Het
Pcnx3 A T 19: 5,684,333 D655E probably damaging Het
Plch1 C T 3: 63,716,029 V617M probably damaging Het
Polk A T 13: 96,484,017 N579K probably damaging Het
Scube2 C A 7: 109,829,128 V513F possibly damaging Het
Skiv2l2 T C 13: 112,914,361 T227A probably damaging Het
Spen T C 4: 141,488,028 M498V unknown Het
Tm7sf3 T A 6: 146,621,890 N163I possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp24 A T 4: 106,420,504 K2277I probably damaging Het
Other mutations in Anxa10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Anxa10 APN 8 62076314 missense probably damaging 1.00
IGL03354:Anxa10 APN 8 62096744 missense probably damaging 1.00
R0826:Anxa10 UTSW 8 62076284 nonsense probably null
R0883:Anxa10 UTSW 8 62077967 missense probably benign 0.40
R0945:Anxa10 UTSW 8 62060245 splice site probably benign
R1124:Anxa10 UTSW 8 62061004 splice site probably null
R1647:Anxa10 UTSW 8 62092584 missense probably damaging 1.00
R2877:Anxa10 UTSW 8 62060339 missense probably damaging 1.00
R3706:Anxa10 UTSW 8 62064287 missense probably damaging 1.00
R4677:Anxa10 UTSW 8 62063020 missense probably damaging 1.00
R5109:Anxa10 UTSW 8 62063059 missense possibly damaging 0.91
R5554:Anxa10 UTSW 8 62061046 missense possibly damaging 0.93
R5971:Anxa10 UTSW 8 62077926 missense probably benign 0.00
R6079:Anxa10 UTSW 8 62077926 missense probably benign 0.00
R6134:Anxa10 UTSW 8 62077943 missense probably damaging 1.00
R6857:Anxa10 UTSW 8 62061017 missense probably benign 0.19
R6901:Anxa10 UTSW 8 62096782 missense probably damaging 1.00
R7428:Anxa10 UTSW 8 62092509 missense probably benign 0.01
Z1088:Anxa10 UTSW 8 62092506 missense probably damaging 0.97
Z1176:Anxa10 UTSW 8 62063070 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTGGTGCTCAGTGAAGCCAAG -3'
(R):5'- CTGTGAGTCCTACAAAAGCAGCCC -3'

Sequencing Primer
(F):5'- TGAAGCCAAGGAAAATAATAGATCC -3'
(R):5'- TAGGATTCATCAAGTATTGCTATTGG -3'
Posted On2013-07-30