Incidental Mutation 'R7932:Pten'
ID611990
Institutional Source Beutler Lab
Gene Symbol Pten
Ensembl Gene ENSMUSG00000013663
Gene Namephosphatase and tensin homolog
SynonymsA130070J02Rik, 2310035O07Rik, B430203M17Rik, MMAC1, TEP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7932 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location32757497-32826160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32799996 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 130 (R130L)
Ref Sequence ENSEMBL: ENSMUSP00000013807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013807]
Predicted Effect probably damaging
Transcript: ENSMUST00000013807
AA Change: R130L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013807
Gene: ENSMUSG00000013663
AA Change: R130L

DomainStartEndE-ValueType
Pfam:Y_phosphatase 42 183 2.7e-6 PFAM
Pfam:DSPc 67 173 2.4e-9 PFAM
PTEN_C2 188 349 4.07e-49 SMART
low complexity region 360 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a phosphatase with dual activity against phospholipids and proteins, and acts as a tumor-suppressor. The protein contains four structural domains, a PIP2-binding domain, a catalytic tensin-type phosphatase domain, a C2 tensin-type domain and a PDZ-binding domain. The protein belongs to the protein tyrosine phosphatase family. Deletion of this gene in mice contribute to tumorigenesis in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die by E9.5 with abnormally patterned enlarged brains and defective placentas. Heterozygotes develop a range of neoplasms. Conditional mutants demonstrate effects on basic processes of proliferation, differentiation and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,026,328 I325N Het
Agap1 T C 1: 89,630,419 V143A probably damaging Het
Agmo A G 12: 37,242,045 R2G probably benign Het
Alms1 A T 6: 85,621,497 I1102L possibly damaging Het
Ankrd13a T C 5: 114,791,282 I140T possibly damaging Het
Arhgef10l T A 4: 140,583,934 probably null Het
Atxn2l A T 7: 126,493,173 H967Q possibly damaging Het
B3galnt2 A T 13: 13,994,492 N370I probably benign Het
BC053393 T A 11: 46,577,231 I44K not run Het
Cacna1e C T 1: 154,633,718 D264N probably damaging Het
Ccdc112 A T 18: 46,296,323 Y103N probably benign Het
Ccdc68 A C 18: 69,947,175 E197A probably damaging Het
Cntn3 T C 6: 102,265,431 M418V probably benign Het
Cpne4 T A 9: 104,686,519 C32S probably damaging Het
Csf2rb2 A T 15: 78,284,421 S845T probably benign Het
Ctnnd2 T G 15: 31,027,587 V1219G probably damaging Het
Cyp4f14 G A 17: 32,909,351 A230V probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 T A 18: 49,961,147 C2897S probably benign Het
Elavl2 T A 4: 91,372,043 probably benign Het
Fam135a T C 1: 24,044,250 E298G probably damaging Het
Fbn1 A T 2: 125,309,485 I2534N probably damaging Het
Fibin A G 2: 110,362,480 S106P probably damaging Het
Fndc3a C T 14: 72,564,660 V568M probably benign Het
Frem2 A G 3: 53,572,374 F1966S probably damaging Het
Gata4 T G 14: 63,204,725 E216A possibly damaging Het
Gmps T A 3: 64,015,563 V649E probably benign Het
Golga4 A T 9: 118,559,311 N1834Y possibly damaging Het
Gpr89 A T 3: 96,871,490 Y422* probably null Het
Gzmc A T 14: 56,232,372 F157Y probably benign Het
Hdhd2 A G 18: 76,965,266 D204G probably damaging Het
Hspa4 T G 11: 53,280,703 T225P possibly damaging Het
Ikbkap A T 4: 56,758,968 S1191T possibly damaging Het
Klhl30 T A 1: 91,359,337 D448E probably benign Het
Kptn A G 7: 16,120,041 Y28C probably damaging Het
Krt10 A T 11: 99,387,606 N242K probably damaging Het
Krt6b A T 15: 101,678,574 N254K probably damaging Het
Lama5 G T 2: 180,201,812 D447E probably damaging Het
Lgr6 T C 1: 134,987,681 Y720C probably damaging Het
Macf1 G C 4: 123,407,599 P1037A probably benign Het
Map3k19 C T 1: 127,823,646 G656D probably benign Het
Mical2 T A 7: 112,323,461 probably null Het
Mroh7 A C 4: 106,721,090 N130K probably benign Het
Muc16 T C 9: 18,640,505 T4831A probably benign Het
Nbea A T 3: 55,990,875 probably null Het
Nfkb1 A T 3: 135,585,412 L533H Het
Olfr1033 G A 2: 86,041,605 V97I probably benign Het
Olfr1265 A G 2: 90,037,282 Y121C probably damaging Het
Olfr151 A G 9: 37,730,707 I92T probably damaging Het
Olfr639 C A 7: 104,012,303 R133L possibly damaging Het
Olfr971 A G 9: 39,840,322 D296G possibly damaging Het
Otub1 T C 19: 7,200,060 D74G probably damaging Het
Oxct2b A G 4: 123,116,887 E200G probably damaging Het
Pcdh1 T C 18: 38,189,609 D1057G probably benign Het
Pkd1 T A 17: 24,586,200 V3242E probably damaging Het
Pla2g4e T A 2: 120,185,322 D247V probably benign Het
Pole T A 5: 110,332,548 M1995K probably benign Het
Ppargc1a T C 5: 51,548,513 E76G probably benign Het
Ptprj A T 2: 90,444,460 V1186D probably damaging Het
Rab4a T A 8: 123,806,137 M1K probably null Het
Rapgef3 C A 15: 97,758,390 probably null Het
Rarb C A 14: 16,548,473 V83F probably damaging Het
Rgs22 A T 15: 36,099,712 F410I probably damaging Het
Rhpn2 A C 7: 35,381,487 E459A probably benign Het
Rims4 A T 2: 163,864,054 L220Q probably damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Sbf2 T C 7: 110,372,510 H839R probably damaging Het
Setbp1 T C 18: 78,856,853 R1200G probably benign Het
Slc12a8 C A 16: 33,624,560 P275T probably damaging Het
Slc23a1 G T 18: 35,624,501 T239N probably benign Het
Slc37a3 T A 6: 39,364,583 T40S possibly damaging Het
Speer4c T C 5: 15,710,927 probably null Het
Tet1 A T 10: 62,819,473 H1556Q possibly damaging Het
Tfcp2l1 T A 1: 118,675,595 D454E probably damaging Het
Tmem123 A T 9: 7,790,889 M64L probably benign Het
Tmem62 A T 2: 120,984,372 H172L probably benign Het
Trim15 T G 17: 36,866,872 Y77S probably benign Het
Trim37 T A 11: 87,201,444 V693E possibly damaging Het
Trim65 A G 11: 116,126,256 L460S probably damaging Het
Ttc39a T C 4: 109,422,490 V109A probably benign Het
Ttc7 A G 17: 87,292,946 M163V probably null Het
Vps13b T C 15: 35,423,232 S233P probably damaging Het
Vwf T C 6: 125,656,803 L2084P Het
Wasl A G 6: 24,633,923 V114A possibly damaging Het
Wdr5 A G 2: 27,519,451 S62G probably damaging Het
Wfdc11 G T 2: 164,665,525 S4* probably null Het
Wfikkn2 C A 11: 94,238,984 M110I probably benign Het
Wiz T G 17: 32,357,786 E588A probably benign Het
Xylt1 A G 7: 117,656,668 H821R probably benign Het
Zbtb7c A T 18: 76,145,701 H410L probably benign Het
Zc3h18 T A 8: 122,383,971 D186E probably damaging Het
Zfp687 G T 3: 95,010,362 L700I possibly damaging Het
Zmym2 T A 14: 56,946,563 M994K probably benign Het
Other mutations in Pten
AlleleSourceChrCoordTypePredicted EffectPPH Score
Brakes UTSW 19 32815497 missense probably benign
Bremse UTSW 19 32800085 missense possibly damaging 0.91
R0131:Pten UTSW 19 32776069 missense probably benign 0.15
R0557:Pten UTSW 19 32817890 missense probably benign
R1387:Pten UTSW 19 32798096 missense probably benign
R1479:Pten UTSW 19 32819850 missense probably damaging 0.99
R1773:Pten UTSW 19 32798072 missense probably damaging 1.00
R4801:Pten UTSW 19 32758503 missense possibly damaging 0.75
R4802:Pten UTSW 19 32758503 missense possibly damaging 0.75
R5196:Pten UTSW 19 32815497 missense probably benign
R5200:Pten UTSW 19 32799891 missense probably damaging 0.97
R5672:Pten UTSW 19 32758466 missense probably benign
R6143:Pten UTSW 19 32800085 missense possibly damaging 0.91
R7644:Pten UTSW 19 32811834 missense probably damaging 1.00
R7849:Pten UTSW 19 32799996 missense probably damaging 1.00
R7867:Pten UTSW 19 32815494 missense probably benign
R7950:Pten UTSW 19 32815494 missense probably benign
Z1088:Pten UTSW 19 32776051 missense probably damaging 0.96
Z1088:Pten UTSW 19 32799998 missense probably damaging 1.00
Z1176:Pten UTSW 19 32798115 critical splice donor site probably null
Z1177:Pten UTSW 19 32811805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGTTTCCATGTCTAATGAATGC -3'
(R):5'- AAGAGGGAGAAAACCTGTTTCCC -3'

Sequencing Primer
(F):5'- AAGTTAGGCTTCTTTTAAGAACCAG -3'
(R):5'- TCCCAATAAATTCTTGGTCCACAAAG -3'
Posted On2019-12-27