Incidental Mutation 'R0687:Nae1'
List |< first << previous [record 6 of 17] next >> last >|
ID61200
Institutional Source Beutler Lab
Gene Symbol Nae1
Ensembl Gene ENSMUSG00000031878
Gene NameNEDD8 activating enzyme E1 subunit 1
SynonymsAppbp1
MMRRC Submission 038872-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0687 (G1)
Quality Score89
Status Not validated
Chromosome8
Chromosomal Location104511028-104534637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104513244 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 484 (R484L)
Ref Sequence ENSEMBL: ENSMUSP00000034349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034349] [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520] [ENSMUST00000162466]
Predicted Effect probably damaging
Transcript: ENSMUST00000034349
AA Change: R484L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034349
Gene: ENSMUSG00000031878
AA Change: R484L

DomainStartEndE-ValueType
Pfam:ThiF 13 533 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064576
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159330
Predicted Effect probably benign
Transcript: ENSMUST00000159713
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161462
Predicted Effect probably benign
Transcript: ENSMUST00000161520
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162014
SMART Domains Protein: ENSMUSP00000123925
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1jdha_ 21 370 7e-8 SMART
low complexity region 382 394 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
low complexity region 688 695 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162466
AA Change: R460L

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125456
Gene: ENSMUSG00000031878
AA Change: R460L

DomainStartEndE-ValueType
PDB:3GZN|C 1 510 N/A PDB
SCOP:d1jw9b_ 9 145 5e-23 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T G 7: 34,245,418 Q679P possibly damaging Het
Anxa10 T A 8: 62,092,572 D42V possibly damaging Het
B3gnt9 T A 8: 105,254,783 probably benign Het
Ccdc150 A T 1: 54,285,631 probably null Het
Fstl5 A G 3: 76,707,812 I727V possibly damaging Het
Nudt19 T A 7: 35,551,472 T281S probably benign Het
Osgin1 T A 8: 119,445,832 V455E probably damaging Het
Pcnx3 A T 19: 5,684,333 D655E probably damaging Het
Plch1 C T 3: 63,716,029 V617M probably damaging Het
Polk A T 13: 96,484,017 N579K probably damaging Het
Scube2 C A 7: 109,829,128 V513F possibly damaging Het
Skiv2l2 T C 13: 112,914,361 T227A probably damaging Het
Spen T C 4: 141,488,028 M498V unknown Het
Tm7sf3 T A 6: 146,621,890 N163I possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp24 A T 4: 106,420,504 K2277I probably damaging Het
Other mutations in Nae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Nae1 APN 8 104526381 missense possibly damaging 0.70
IGL00585:Nae1 APN 8 104526278 critical splice donor site probably null
IGL00765:Nae1 APN 8 104517950 splice site probably benign
IGL01420:Nae1 APN 8 104523165 missense probably benign 0.00
IGL02314:Nae1 APN 8 104526306 missense probably damaging 0.99
IGL02565:Nae1 APN 8 104511209 missense probably damaging 1.00
IGL03202:Nae1 APN 8 104518179 splice site probably benign
IGL03266:Nae1 APN 8 104513196 splice site probably benign
pixy_stix UTSW 8 104519784 missense probably damaging 1.00
taebaeksan UTSW 8 104530391 critical splice donor site probably null
R0436:Nae1 UTSW 8 104523236 splice site probably benign
R1500:Nae1 UTSW 8 104523584 missense probably benign 0.06
R1746:Nae1 UTSW 8 104527385 missense possibly damaging 0.74
R2241:Nae1 UTSW 8 104519788 missense probably benign 0.00
R2255:Nae1 UTSW 8 104530068 missense probably damaging 1.00
R4821:Nae1 UTSW 8 104519784 missense probably damaging 1.00
R4928:Nae1 UTSW 8 104516142 missense possibly damaging 0.76
R5062:Nae1 UTSW 8 104516702 missense possibly damaging 0.60
R5240:Nae1 UTSW 8 104523144 intron probably benign
R5250:Nae1 UTSW 8 104530391 critical splice donor site probably null
R6052:Nae1 UTSW 8 104534544 missense probably benign 0.01
R6075:Nae1 UTSW 8 104524369 missense possibly damaging 0.77
R6108:Nae1 UTSW 8 104527402 missense probably benign 0.07
R6318:Nae1 UTSW 8 104523637 missense probably benign 0.40
R7120:Nae1 UTSW 8 104526278 critical splice donor site probably null
R7202:Nae1 UTSW 8 104523583 missense possibly damaging 0.77
R7491:Nae1 UTSW 8 104518239 missense probably benign 0.13
R7659:Nae1 UTSW 8 104516164 missense probably benign 0.26
R8120:Nae1 UTSW 8 104519635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAATGGCAGGTTTTCACTGGGC -3'
(R):5'- GGCTTCCTTCAGGAATATGGGCTG -3'

Sequencing Primer
(F):5'- gagggggaggaggaagg -3'
(R):5'- CAGGAATATGGGCTGTCTGTAATG -3'
Posted On2013-07-30