Incidental Mutation 'R0687:Osgin1'
List |< first << previous [record 8 of 17] next >> last >|
ID61201
Institutional Source Beutler Lab
Gene Symbol Osgin1
Ensembl Gene ENSMUSG00000074063
Gene Nameoxidative stress induced growth inhibitor 1
Synonyms1700012B18Rik
MMRRC Submission 038872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0687 (G1)
Quality Score197
Status Not validated
Chromosome8
Chromosomal Location119434124-119446256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119445832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 455 (V455E)
Ref Sequence ENSEMBL: ENSMUSP00000114467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098363] [ENSMUST00000098365] [ENSMUST00000131448] [ENSMUST00000152420] [ENSMUST00000212112]
Predicted Effect probably benign
Transcript: ENSMUST00000098363
SMART Domains Protein: ENSMUSP00000095966
Gene: ENSMUSG00000031837

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
EFh 67 95 4.06e-2 SMART
EFh 101 129 3.21e0 SMART
low complexity region 185 196 N/A INTRINSIC
Pfam:ABM 289 363 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126414
Predicted Effect probably benign
Transcript: ENSMUST00000131448
SMART Domains Protein: ENSMUSP00000120477
Gene: ENSMUSG00000074063

DomainStartEndE-ValueType
SCOP:d1foha5 12 38 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145604
Predicted Effect probably damaging
Transcript: ENSMUST00000152420
AA Change: V455E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114467
Gene: ENSMUSG00000074063
AA Change: V455E

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 205 465 3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212112
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an oxidative stress response protein that regulates cell death. Expression of the gene is regulated by p53 and is induced by DNA damage. The protein regulates apoptosis by inducing cytochrome c release from mitochondria. It also appears to be a key regulator of both inflammatory and anti-inflammatory molecules. The loss of this protein correlates with uncontrolled cell growth and tumor formation. Naturally occurring read-through transcription exists between this gene and the neighboring upstream malonyl-CoA decarboxylase (MLYCD) gene, but the read-through transcripts are unlikely to produce a protein product. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T G 7: 34,245,418 Q679P possibly damaging Het
Anxa10 T A 8: 62,092,572 D42V possibly damaging Het
B3gnt9 T A 8: 105,254,783 probably benign Het
Ccdc150 A T 1: 54,285,631 probably null Het
Fstl5 A G 3: 76,707,812 I727V possibly damaging Het
Nae1 C A 8: 104,513,244 R484L probably damaging Het
Nudt19 T A 7: 35,551,472 T281S probably benign Het
Pcnx3 A T 19: 5,684,333 D655E probably damaging Het
Plch1 C T 3: 63,716,029 V617M probably damaging Het
Polk A T 13: 96,484,017 N579K probably damaging Het
Scube2 C A 7: 109,829,128 V513F possibly damaging Het
Skiv2l2 T C 13: 112,914,361 T227A probably damaging Het
Spen T C 4: 141,488,028 M498V unknown Het
Tm7sf3 T A 6: 146,621,890 N163I possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp24 A T 4: 106,420,504 K2277I probably damaging Het
Other mutations in Osgin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Osgin1 APN 8 119445046 missense probably damaging 0.97
IGL02347:Osgin1 APN 8 119445538 missense probably benign 0.02
IGL02803:Osgin1 APN 8 119443267 missense probably benign 0.00
IGL03111:Osgin1 APN 8 119443049 missense probably damaging 0.96
R0137:Osgin1 UTSW 8 119442480 missense possibly damaging 0.73
R0265:Osgin1 UTSW 8 119445657 missense possibly damaging 0.94
R0520:Osgin1 UTSW 8 119442508 missense probably damaging 1.00
R0650:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0652:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R1439:Osgin1 UTSW 8 119443113 splice site probably null
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R2058:Osgin1 UTSW 8 119445673 missense possibly damaging 0.87
R2982:Osgin1 UTSW 8 119442535 missense probably damaging 1.00
R3880:Osgin1 UTSW 8 119441452 missense probably benign
R4076:Osgin1 UTSW 8 119445033 missense possibly damaging 0.64
R4594:Osgin1 UTSW 8 119445253 missense possibly damaging 0.49
R4914:Osgin1 UTSW 8 119442544 missense possibly damaging 0.91
R4991:Osgin1 UTSW 8 119445289 missense probably damaging 1.00
R5689:Osgin1 UTSW 8 119444989 makesense probably null
R6215:Osgin1 UTSW 8 119445444 missense probably benign 0.01
R7008:Osgin1 UTSW 8 119441494 missense possibly damaging 0.92
R7136:Osgin1 UTSW 8 119441437 start codon destroyed probably null 0.51
R7380:Osgin1 UTSW 8 119445431 missense probably benign 0.44
R7840:Osgin1 UTSW 8 119445034 missense possibly damaging 0.78
R7923:Osgin1 UTSW 8 119445034 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGCTGCCCAAGATGCTATACCCTG -3'
(R):5'- GTCCATCCACATGGCTCAAGTCTTC -3'

Sequencing Primer
(F):5'- AGATGATGCGCGATCAGTCC -3'
(R):5'- GGGAGACTGGTTCCCAAATG -3'
Posted On2013-07-30