Incidental Mutation 'R7933:Papln'
ID612023
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Namepapilin, proteoglycan-like sulfated glycoprotein
SynonymsE030033C16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7933 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location83763634-83792382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83780662 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 758 (E758V)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
Predicted Effect probably damaging
Transcript: ENSMUST00000021646
AA Change: E736V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: E736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121733
AA Change: E758V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: E758V

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,068,128 D2E probably damaging Het
Abhd16b G A 2: 181,493,725 R140H not run Het
Acad11 G T 9: 104,114,529 G588C probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Bcas1 A G 2: 170,348,103 S625P probably damaging Het
Bdp1 T A 13: 100,092,324 L265F probably damaging Het
Cacna1s A G 1: 136,071,048 Y227C probably damaging Het
Cacna2d2 G A 9: 107,525,376 A848T probably benign Het
Cep135 T C 5: 76,591,873 probably null Het
Cyp2b9 G T 7: 26,186,686 E93* probably null Het
Dcp2 C A 18: 44,400,348 S122* probably null Het
Ecel1 A G 1: 87,152,023 L456P probably damaging Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Gcc2 T A 10: 58,278,881 V1084D probably damaging Het
Grem1 A G 2: 113,749,833 C108R probably damaging Het
Gtf2ird1 T C 5: 134,363,215 E880G probably benign Het
Hacd2 T A 16: 35,102,107 M222K probably damaging Het
Htt T G 5: 34,852,287 probably null Het
Ifnab T G 4: 88,690,896 D111A probably benign Het
Igsf10 A T 3: 59,319,632 L2207I probably benign Het
Itln1 T C 1: 171,530,598 Y194C probably damaging Het
Kmt5b T A 19: 3,815,043 D702E probably damaging Het
Knop1 T C 7: 118,850,637 E382G unknown Het
Lrit3 A C 3: 129,800,803 L42V probably damaging Het
Mug2 A G 6: 122,075,211 E976G probably damaging Het
Olfr1436 T C 19: 12,298,632 M167V probably benign Het
Olfr281 G A 15: 98,457,068 G253R probably damaging Het
Olfr945 A T 9: 39,258,222 I150N possibly damaging Het
Pcnx3 A C 19: 5,678,932 F967V possibly damaging Het
Pcnx4 G T 12: 72,556,068 C368F probably benign Het
Pi15 T A 1: 17,602,881 Y101* probably null Het
Ppp1r9a G A 6: 4,905,894 V150M possibly damaging Het
Prrt4 A T 6: 29,176,901 probably null Het
Ptgdr A G 14: 44,853,371 V310A probably benign Het
Ric1 G A 19: 29,594,893 S696N probably benign Het
Setx T A 2: 29,147,418 V1305D probably damaging Het
Slk G A 19: 47,622,357 R822H probably damaging Het
Tas2r135 T A 6: 42,406,138 F204I probably benign Het
Tcaf3 A T 6: 42,594,206 probably null Het
Tmtc2 A G 10: 105,573,707 Y15H probably benign Het
Treml2 T C 17: 48,308,140 S218P probably benign Het
Tubb2a T C 13: 34,074,571 E412G probably damaging Het
Usp48 T G 4: 137,605,749 probably null Het
Vmn2r25 A T 6: 123,828,472 N475K probably damaging Het
Zscan4-ps1 G A 7: 11,065,808 H385Y probably benign Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83770436 missense possibly damaging 0.81
IGL01788:Papln APN 12 83775462 missense probably benign 0.32
IGL01889:Papln APN 12 83786835 missense probably benign 0.25
IGL02499:Papln APN 12 83780671 missense probably benign 0.00
IGL02567:Papln APN 12 83778837 missense probably benign 0.00
IGL03150:Papln APN 12 83782984 missense probably damaging 1.00
IGL03331:Papln APN 12 83783661 missense probably benign
F5770:Papln UTSW 12 83778834 missense possibly damaging 0.72
R0201:Papln UTSW 12 83783027 splice site probably benign
R0389:Papln UTSW 12 83783379 nonsense probably null
R0763:Papln UTSW 12 83791865 missense possibly damaging 0.54
R1508:Papln UTSW 12 83782916 missense probably damaging 0.99
R1628:Papln UTSW 12 83784406 splice site probably benign
R1920:Papln UTSW 12 83789254 nonsense probably null
R1974:Papln UTSW 12 83782037 missense probably damaging 0.98
R2004:Papln UTSW 12 83773218 missense probably damaging 1.00
R2105:Papln UTSW 12 83780236 missense probably benign 0.04
R2876:Papln UTSW 12 83778927 missense probably damaging 0.96
R4199:Papln UTSW 12 83783392 missense probably null 0.01
R4702:Papln UTSW 12 83781983 missense probably benign 0.01
R4705:Papln UTSW 12 83777208 splice site probably null
R4835:Papln UTSW 12 83774420 missense probably damaging 0.99
R4874:Papln UTSW 12 83777143 missense probably benign 0.01
R4938:Papln UTSW 12 83782903 missense probably benign 0.35
R5000:Papln UTSW 12 83774889 missense probably damaging 1.00
R5149:Papln UTSW 12 83771882 splice site probably null
R5324:Papln UTSW 12 83774571 missense probably damaging 1.00
R5784:Papln UTSW 12 83781980 missense probably benign
R5881:Papln UTSW 12 83771878 missense probably null 0.91
R5977:Papln UTSW 12 83784369 nonsense probably null
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6291:Papln UTSW 12 83783015 missense probably benign 0.01
R6461:Papln UTSW 12 83781813 splice site probably null
R6536:Papln UTSW 12 83781887 missense probably damaging 1.00
R6861:Papln UTSW 12 83774949 missense probably damaging 1.00
R6898:Papln UTSW 12 83777460 missense probably benign 0.03
R6953:Papln UTSW 12 83781885 nonsense probably null
R7155:Papln UTSW 12 83776521 missense probably damaging 1.00
R7450:Papln UTSW 12 83780171 missense probably benign 0.13
R7510:Papln UTSW 12 83772173 missense probably damaging 0.99
R7850:Papln UTSW 12 83780662 missense probably damaging 1.00
V7580:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7581:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7582:Papln UTSW 12 83778834 missense possibly damaging 0.72
Z1088:Papln UTSW 12 83776376 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTGCCTCTGACTCATAGCTG -3'
(R):5'- AACATCTTAGATGCAGGGCC -3'

Sequencing Primer
(F):5'- TCCCTCTGGTCAGCCCAAG -3'
(R):5'- CGTCCCTCTGGCCTGGTATC -3'
Posted On2019-12-27