Incidental Mutation 'R7934:Pced1a'
ID612048
Institutional Source Beutler Lab
Gene Symbol Pced1a
Ensembl Gene ENSMUSG00000037773
Gene NamePC-esterase domain containing 1A
SynonymsFam113a, A930025D01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7934 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130417247-130424701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130422316 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 168 (M168K)
Ref Sequence ENSEMBL: ENSMUSP00000087009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]
Predicted Effect probably benign
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089581
AA Change: M168K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773
AA Change: M168K

DomainStartEndE-ValueType
Pfam:PC-Esterase 18 267 4e-52 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110277
AA Change: M168K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773
AA Change: M168K

DomainStartEndE-ValueType
Pfam:PC-Esterase 21 268 3.8e-51 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Pced1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pced1a APN 2 130419178 missense probably benign 0.00
IGL02173:Pced1a APN 2 130422328 missense possibly damaging 0.46
IGL02547:Pced1a APN 2 130419707 missense possibly damaging 0.74
IGL02729:Pced1a APN 2 130421903 missense probably benign 0.01
IGL03107:Pced1a APN 2 130422835 missense possibly damaging 0.81
R0139:Pced1a UTSW 2 130421907 missense probably benign 0.00
R0550:Pced1a UTSW 2 130419633 missense probably benign 0.00
R0578:Pced1a UTSW 2 130419843 missense probably damaging 0.98
R3037:Pced1a UTSW 2 130419859 missense probably benign 0.40
R3157:Pced1a UTSW 2 130419767 missense probably benign 0.12
R4578:Pced1a UTSW 2 130422676 missense probably damaging 1.00
R5306:Pced1a UTSW 2 130419171 missense probably benign
R6210:Pced1a UTSW 2 130421919 missense probably damaging 1.00
R7444:Pced1a UTSW 2 130422059 missense probably damaging 0.98
R7459:Pced1a UTSW 2 130419824 missense possibly damaging 0.59
R7524:Pced1a UTSW 2 130422028 missense probably benign 0.44
R7744:Pced1a UTSW 2 130422052 missense probably damaging 1.00
R7782:Pced1a UTSW 2 130422515 missense probably damaging 0.99
R7851:Pced1a UTSW 2 130422316 missense probably damaging 0.99
Z1177:Pced1a UTSW 2 130422628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCACATCCTGTCGCAGAG -3'
(R):5'- CTAGTGATCATCAACTCCTGCC -3'

Sequencing Primer
(F):5'- AGCTAATTGACAAAGTGGAGTCTC -3'
(R):5'- CTCTGGGATCTCTCCAGGTTCAG -3'
Posted On2019-12-27