Incidental Mutation 'R7934:Plch1'
ID612051
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7934 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63698434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1350 (S1350G)
Ref Sequence ENSEMBL: ENSMUSP00000081122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect probably damaging
Transcript: ENSMUST00000048134
AA Change: S1311G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: S1311G

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059973
AA Change: S1349G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: S1349G

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084105
AA Change: S1350G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: S1350G

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159676
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160638
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162269
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175947
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176861
Predicted Effect probably damaging
Transcript: ENSMUST00000177143
AA Change: S1341G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: S1341G

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0738:Plch1 UTSW 3 63702553 intron probably benign
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1678:Plch1 UTSW 3 63740694 missense probably damaging 1.00
R1738:Plch1 UTSW 3 63719238 missense probably benign 0.12
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R1955:Plch1 UTSW 3 63755267 missense probably damaging 0.98
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6316:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6767:Plch1 UTSW 3 63755344 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
R7298:Plch1 UTSW 3 63716037 nonsense probably null
R7396:Plch1 UTSW 3 63698954 missense probably benign 0.00
R7420:Plch1 UTSW 3 63722857 missense probably damaging 1.00
R7566:Plch1 UTSW 3 63781242 intron probably null
R7572:Plch1 UTSW 3 63740684 missense possibly damaging 0.89
R7649:Plch1 UTSW 3 63698169 nonsense probably null
R7696:Plch1 UTSW 3 63755305 missense probably benign
R7851:Plch1 UTSW 3 63698434 missense probably damaging 0.99
R7853:Plch1 UTSW 3 63773647 missense probably benign 0.44
R7936:Plch1 UTSW 3 63773647 missense probably benign 0.44
R8057:Plch1 UTSW 3 63698136 missense probably benign
R8066:Plch1 UTSW 3 63711057 nonsense probably null
RF018:Plch1 UTSW 3 63721215 missense probably damaging 1.00
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAGGAGAGTCTCTTTACAGTAGC -3'
(R):5'- TGGAGTGATTGGTTCTCCCATC -3'

Sequencing Primer
(F):5'- GGAGAGTCTCTTTACAGTAGCCATTC -3'
(R):5'- CCAGGTGATGACCCTTCAGATAAG -3'
Posted On2019-12-27