Incidental Mutation 'R7934:Spire2'
ID612072
Institutional Source Beutler Lab
Gene Symbol Spire2
Ensembl Gene ENSMUSG00000010154
Gene Namespire type actin nucleation factor 2
SynonymsSpir-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7934 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123332713-123369515 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 123356699 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010298] [ENSMUST00000127664] [ENSMUST00000212404]
Predicted Effect probably null
Transcript: ENSMUST00000010298
SMART Domains Protein: ENSMUSP00000010298
Gene: ENSMUSG00000010154

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
KIND 26 207 2.63e-82 SMART
PDB:4EFH|B 310 360 8e-8 PDB
low complexity region 419 431 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
SCOP:d1zbdb_ 540 636 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212404
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Spire2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Spire2 APN 8 123354059 missense probably damaging 1.00
IGL01610:Spire2 APN 8 123356763 missense probably damaging 1.00
IGL01611:Spire2 APN 8 123359398 missense probably damaging 1.00
IGL01776:Spire2 APN 8 123359392 missense probably damaging 0.98
IGL02164:Spire2 APN 8 123332964 missense probably damaging 0.99
IGL03005:Spire2 APN 8 123363368 missense probably benign 0.16
R0127:Spire2 UTSW 8 123358097 splice site probably benign
R0194:Spire2 UTSW 8 123363011 splice site probably benign
R0571:Spire2 UTSW 8 123354116 missense probably damaging 1.00
R1386:Spire2 UTSW 8 123361366 critical splice donor site probably null
R1526:Spire2 UTSW 8 123368763 missense probably benign 0.08
R1538:Spire2 UTSW 8 123358156 missense probably damaging 1.00
R1917:Spire2 UTSW 8 123363071 missense probably benign 0.00
R1919:Spire2 UTSW 8 123363071 missense probably benign 0.00
R2018:Spire2 UTSW 8 123332918 missense probably damaging 1.00
R2019:Spire2 UTSW 8 123332918 missense probably damaging 1.00
R4524:Spire2 UTSW 8 123360235 missense probably benign
R4672:Spire2 UTSW 8 123358111 missense probably benign 0.06
R4931:Spire2 UTSW 8 123368784 missense possibly damaging 0.54
R4973:Spire2 UTSW 8 123356844 missense probably damaging 1.00
R5057:Spire2 UTSW 8 123358201 missense probably damaging 1.00
R5702:Spire2 UTSW 8 123346663 missense probably benign 0.07
R5899:Spire2 UTSW 8 123354094 missense probably damaging 1.00
R6747:Spire2 UTSW 8 123356846 missense probably damaging 1.00
R6816:Spire2 UTSW 8 123359413 missense probably benign 0.12
R6823:Spire2 UTSW 8 123356727 missense probably damaging 1.00
R7146:Spire2 UTSW 8 123369250 missense probably benign 0.08
R7903:Spire2 UTSW 8 123368750 missense probably benign
R7986:Spire2 UTSW 8 123368750 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGAGAAGTGCCTCCTGCTG -3'
(R):5'- CAGCTTATAGTTCCTGGCACG -3'

Sequencing Primer
(F):5'- CATATGTATGGTCCCAGATGCTGAAG -3'
(R):5'- ATAGTTCCTGGCACGGATATC -3'
Posted On2019-12-27