Incidental Mutation 'R0688:Slc27a4'
ID61209
Institutional Source Beutler Lab
Gene Symbol Slc27a4
Ensembl Gene ENSMUSG00000059316
Gene Namesolute carrier family 27 (fatty acid transporter), member 4
SynonymsFATP4, fatty acid transport protein 4
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0688 (G1)
Quality Score115
Status Not validated
Chromosome2
Chromosomal Location29802634-29817522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29812615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 509 (F509S)
Ref Sequence ENSEMBL: ENSMUSP00000078971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080065]
Predicted Effect probably damaging
Transcript: ENSMUST00000080065
AA Change: F509S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078971
Gene: ENSMUSG00000059316
AA Change: F509S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:AMP-binding 80 512 1.2e-72 PFAM
Pfam:AMP-binding_C 520 595 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136444
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutant mice are not viable. While mice of one mutant line die during early development, mice of other mutant lines die at birth exhibiting abnormal skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Slc27a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc27a4 APN 2 29804302 missense probably benign 0.03
IGL01982:Slc27a4 APN 2 29812615 missense probably damaging 1.00
IGL02160:Slc27a4 APN 2 29805962 missense probably benign 0.04
IGL02290:Slc27a4 APN 2 29815729 missense probably damaging 1.00
IGL02382:Slc27a4 APN 2 29809843 missense probably damaging 1.00
IGL02738:Slc27a4 APN 2 29811226 missense probably benign 0.15
R0470:Slc27a4 UTSW 2 29804185 missense probably benign 0.10
R0847:Slc27a4 UTSW 2 29811249 missense probably benign 0.20
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1584:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1793:Slc27a4 UTSW 2 29805721 missense probably benign 0.00
R1804:Slc27a4 UTSW 2 29811267 missense probably benign 0.01
R2056:Slc27a4 UTSW 2 29810941 missense probably damaging 0.99
R4901:Slc27a4 UTSW 2 29812636 missense probably damaging 1.00
R5601:Slc27a4 UTSW 2 29805660 missense probably benign 0.30
R5663:Slc27a4 UTSW 2 29812370 missense probably damaging 1.00
R5934:Slc27a4 UTSW 2 29811660 missense probably damaging 0.96
R6196:Slc27a4 UTSW 2 29805750 missense probably benign 0.00
R6643:Slc27a4 UTSW 2 29812848 missense probably benign 0.01
R7033:Slc27a4 UTSW 2 29804271 missense possibly damaging 0.94
R7176:Slc27a4 UTSW 2 29811226 missense probably benign 0.15
R7179:Slc27a4 UTSW 2 29815652 nonsense probably null
R7192:Slc27a4 UTSW 2 29805929 missense probably damaging 1.00
R7301:Slc27a4 UTSW 2 29812932 missense probably null 0.99
R7500:Slc27a4 UTSW 2 29812705 missense probably damaging 0.99
R7810:Slc27a4 UTSW 2 29805710 missense probably benign 0.25
R8042:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCCAGTCTCAGAGAACACATCC -3'
(R):5'- TGTGCAAAGCTCTCCAGGTCACAG -3'

Sequencing Primer
(F):5'- AACACATCCCCTGTGATGACTTC -3'
(R):5'- CCAGGTCACAGTTGCTGATG -3'
Posted On2013-07-30