Incidental Mutation 'R7935:Cep152'
ID612104
Institutional Source Beutler Lab
Gene Symbol Cep152
Ensembl Gene ENSMUSG00000068394
Gene Namecentrosomal protein 152
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125563088-125625113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125590113 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 622 (N622K)
Ref Sequence ENSEMBL: ENSMUSP00000087208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089776
AA Change: N622K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394
AA Change: N622K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
coiled coil region 228 481 N/A INTRINSIC
low complexity region 582 593 N/A INTRINSIC
coiled coil region 602 651 N/A INTRINSIC
coiled coil region 692 770 N/A INTRINSIC
low complexity region 780 793 N/A INTRINSIC
coiled coil region 835 868 N/A INTRINSIC
coiled coil region 954 1038 N/A INTRINSIC
coiled coil region 1205 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm4565 A G 7: 22,583,273 V40A possibly damaging Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Shmt2 G A 10: 127,519,331 probably null Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Cep152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cep152 APN 2 125563888 missense probably benign 0.01
IGL00561:Cep152 APN 2 125563723 nonsense probably null
IGL01082:Cep152 APN 2 125569545 splice site probably benign
IGL01420:Cep152 APN 2 125563652 missense possibly damaging 0.49
IGL01832:Cep152 APN 2 125618494 nonsense probably null
IGL02106:Cep152 APN 2 125602936 splice site probably null
IGL02124:Cep152 APN 2 125563461 missense probably benign 0.23
IGL02349:Cep152 APN 2 125594956 missense probably damaging 0.99
IGL02541:Cep152 APN 2 125605354 missense probably damaging 1.00
IGL02659:Cep152 APN 2 125579549 missense probably damaging 0.96
IGL02711:Cep152 APN 2 125563942 missense possibly damaging 0.93
IGL02737:Cep152 APN 2 125586474 missense possibly damaging 0.71
IGL03060:Cep152 APN 2 125619987 splice site probably benign
IGL03095:Cep152 APN 2 125618451 missense probably benign 0.00
IGL03186:Cep152 APN 2 125563975 missense probably benign
IGL03306:Cep152 APN 2 125605408 missense possibly damaging 0.90
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0079:Cep152 UTSW 2 125618453 missense possibly damaging 0.92
R0244:Cep152 UTSW 2 125564214 missense probably benign 0.00
R0390:Cep152 UTSW 2 125576869 splice site probably benign
R0462:Cep152 UTSW 2 125583934 missense possibly damaging 0.64
R0480:Cep152 UTSW 2 125581719 missense possibly damaging 0.95
R0595:Cep152 UTSW 2 125595063 missense probably damaging 0.99
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R1634:Cep152 UTSW 2 125583889 missense probably benign 0.00
R1664:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1693:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1887:Cep152 UTSW 2 125620305 missense probably benign 0.00
R1930:Cep152 UTSW 2 125618371 critical splice donor site probably null
R2178:Cep152 UTSW 2 125580034 splice site probably null
R2225:Cep152 UTSW 2 125581784 missense probably damaging 1.00
R2324:Cep152 UTSW 2 125563462 missense probably benign 0.38
R2416:Cep152 UTSW 2 125564172 nonsense probably null
R2845:Cep152 UTSW 2 125587974 missense probably damaging 1.00
R3753:Cep152 UTSW 2 125625052 unclassified probably benign
R4212:Cep152 UTSW 2 125620001 missense probably benign 0.00
R4304:Cep152 UTSW 2 125563723 nonsense probably null
R4371:Cep152 UTSW 2 125613047 missense probably damaging 1.00
R4399:Cep152 UTSW 2 125587980 missense possibly damaging 0.63
R4536:Cep152 UTSW 2 125602947 splice site probably null
R4713:Cep152 UTSW 2 125587948 missense possibly damaging 0.79
R4777:Cep152 UTSW 2 125564095 missense probably benign 0.29
R4779:Cep152 UTSW 2 125568892 missense possibly damaging 0.52
R4785:Cep152 UTSW 2 125586329 critical splice donor site probably null
R4816:Cep152 UTSW 2 125563754 missense probably damaging 1.00
R4847:Cep152 UTSW 2 125618474 missense possibly damaging 0.62
R4898:Cep152 UTSW 2 125586381 missense probably benign 0.03
R4934:Cep152 UTSW 2 125611096 missense possibly damaging 0.52
R4997:Cep152 UTSW 2 125586351 missense probably benign 0.00
R5068:Cep152 UTSW 2 125571816 missense probably benign 0.25
R5183:Cep152 UTSW 2 125566638 missense probably damaging 1.00
R5198:Cep152 UTSW 2 125587624 missense probably benign
R5261:Cep152 UTSW 2 125564205 missense probably benign 0.06
R5272:Cep152 UTSW 2 125611030 missense probably benign 0.27
R5284:Cep152 UTSW 2 125580021 missense probably damaging 1.00
R6029:Cep152 UTSW 2 125563632 missense probably benign 0.44
R6155:Cep152 UTSW 2 125581700 missense probably benign
R6239:Cep152 UTSW 2 125579412 missense probably benign 0.40
R6590:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6690:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6754:Cep152 UTSW 2 125587668 missense probably damaging 0.99
R6798:Cep152 UTSW 2 125566527 splice site probably null
R6816:Cep152 UTSW 2 125595027 missense probably damaging 1.00
R6977:Cep152 UTSW 2 125568822 critical splice donor site probably null
R7125:Cep152 UTSW 2 125566673 nonsense probably null
R7146:Cep152 UTSW 2 125614405 missense probably benign 0.06
R7588:Cep152 UTSW 2 125569626 missense probably damaging 1.00
R7852:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7883:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R7966:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R8047:Cep152 UTSW 2 125564327 missense probably benign 0.10
X0009:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0010:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0011:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0014:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0017:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0021:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0022:Cep152 UTSW 2 125620063 missense probably benign 0.07
X0023:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0028:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0033:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0064:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0067:Cep152 UTSW 2 125614386 missense probably damaging 1.00
Z1176:Cep152 UTSW 2 125583971 missense probably benign 0.23
Z1177:Cep152 UTSW 2 125614324 missense probably benign 0.33
Z1177:Cep152 UTSW 2 125619704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCTAGGCTACCACATG -3'
(R):5'- TTCTGCCTTGAGGACAAAGAAG -3'

Sequencing Primer
(F):5'- TGGCTAGGCTACCACATGAAACAG -3'
(R):5'- CAGGGAAATTATCTGGTAAACACC -3'
Posted On2019-12-27