Incidental Mutation 'R7935:Kif12'
ID612111
Institutional Source Beutler Lab
Gene Symbol Kif12
Ensembl Gene ENSMUSG00000028357
Gene Namekinesin family member 12
SynonymsN-9 kinesin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location63165630-63172131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 63167989 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 374 (P374A)
Ref Sequence ENSEMBL: ENSMUSP00000030042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]
Predicted Effect probably benign
Transcript: ENSMUST00000030042
AA Change: P374A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357
AA Change: P374A

DomainStartEndE-ValueType
KISc 23 368 4.46e-108 SMART
coiled coil region 376 464 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124739
Predicted Effect probably benign
Transcript: ENSMUST00000154234
Predicted Effect probably benign
Transcript: ENSMUST00000156618
AA Change: P374A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm4565 A G 7: 22,583,273 V40A possibly damaging Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Shmt2 G A 10: 127,519,331 probably null Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Kif12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Kif12 APN 4 63165884 missense probably damaging 0.99
IGL01377:Kif12 APN 4 63170725 missense probably damaging 1.00
IGL02232:Kif12 APN 4 63166495 missense probably benign 0.00
IGL02671:Kif12 APN 4 63170457 missense probably benign 0.05
IGL02719:Kif12 APN 4 63167796 missense probably benign
IGL03056:Kif12 APN 4 63166956 missense probably null 0.00
ANU05:Kif12 UTSW 4 63171423 small insertion probably benign
ANU23:Kif12 UTSW 4 63165884 missense probably damaging 0.99
ANU74:Kif12 UTSW 4 63171423 small insertion probably benign
ANU74:Kif12 UTSW 4 63171426 frame shift probably null
IGL02984:Kif12 UTSW 4 63171423 small insertion probably benign
R0401:Kif12 UTSW 4 63169525 splice site probably benign
R0927:Kif12 UTSW 4 63168773 missense possibly damaging 0.71
R1589:Kif12 UTSW 4 63166500 missense probably benign 0.00
R2178:Kif12 UTSW 4 63166959 missense probably benign 0.00
R2263:Kif12 UTSW 4 63169521 missense probably benign 0.00
R2372:Kif12 UTSW 4 63168559 missense possibly damaging 0.64
R2404:Kif12 UTSW 4 63170553 missense probably damaging 1.00
R3903:Kif12 UTSW 4 63167976 missense possibly damaging 0.73
R4126:Kif12 UTSW 4 63166437 missense probably benign 0.00
R4271:Kif12 UTSW 4 63170746 missense probably benign 0.39
R4386:Kif12 UTSW 4 63171218 missense probably damaging 1.00
R4750:Kif12 UTSW 4 63167783 missense probably damaging 0.99
R4945:Kif12 UTSW 4 63168493 critical splice donor site probably null
R5177:Kif12 UTSW 4 63167904 missense probably benign 0.13
R5421:Kif12 UTSW 4 63171428 missense probably benign 0.40
R5644:Kif12 UTSW 4 63165893 missense possibly damaging 0.75
R5757:Kif12 UTSW 4 63170518 missense probably damaging 1.00
R5772:Kif12 UTSW 4 63165941 missense probably damaging 1.00
R5858:Kif12 UTSW 4 63166410 missense probably benign 0.04
R5929:Kif12 UTSW 4 63168517 missense probably damaging 0.96
R6648:Kif12 UTSW 4 63171317 critical splice donor site probably null
R7007:Kif12 UTSW 4 63166480 missense probably benign
R7108:Kif12 UTSW 4 63171205 missense probably benign 0.15
R7171:Kif12 UTSW 4 63168694 missense probably damaging 1.00
R7852:Kif12 UTSW 4 63167989 missense probably benign 0.13
RF011:Kif12 UTSW 4 63171427 small insertion probably benign
RF031:Kif12 UTSW 4 63171425 small insertion probably benign
RF036:Kif12 UTSW 4 63171427 small insertion probably benign
RF039:Kif12 UTSW 4 63171425 small insertion probably benign
RF041:Kif12 UTSW 4 63171425 small insertion probably benign
T0975:Kif12 UTSW 4 63171423 small insertion probably benign
Z1088:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171997 missense possibly damaging 0.95
Z1177:Kif12 UTSW 4 63171423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGCAGCATCCCATAGAG -3'
(R):5'- CCTTCAGGATGATGCAGTAAAGAC -3'

Sequencing Primer
(F):5'- GCAGCATCCCATAGAGGTTTC -3'
(R):5'- ACGAGGTATGACCCAGGC -3'
Posted On2019-12-27