Incidental Mutation 'R7935:Vmn2r52'
ID612123
Institutional Source Beutler Lab
Gene Symbol Vmn2r52
Ensembl Gene ENSMUSG00000091930
Gene Namevomeronasal 2, receptor 52
SynonymsEG384534
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location10158652-10176286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10158968 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 748 (Y748C)
Ref Sequence ENSEMBL: ENSMUSP00000129352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164918]
Predicted Effect probably damaging
Transcript: ENSMUST00000164918
AA Change: Y748C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129352
Gene: ENSMUSG00000091930
AA Change: Y748C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 8.1e-29 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 596 833 1.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm4565 A G 7: 22,583,273 V40A possibly damaging Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Shmt2 G A 10: 127,519,331 probably null Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Vmn2r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r52 APN 7 10169096 missense probably benign 0.30
IGL00328:Vmn2r52 APN 7 10171417 missense probably benign 0.12
IGL00980:Vmn2r52 APN 7 10171090 missense probably damaging 1.00
IGL01468:Vmn2r52 APN 7 10158941 missense probably damaging 1.00
IGL01660:Vmn2r52 APN 7 10159180 missense probably damaging 0.97
IGL02215:Vmn2r52 APN 7 10171102 missense probably damaging 0.97
IGL03030:Vmn2r52 APN 7 10158872 missense probably benign 0.12
IGL03212:Vmn2r52 APN 7 10159547 missense possibly damaging 0.47
FR4589:Vmn2r52 UTSW 7 10159020 missense probably damaging 0.97
PIT4283001:Vmn2r52 UTSW 7 10170829 missense possibly damaging 0.89
R0184:Vmn2r52 UTSW 7 10159338 missense probably damaging 1.00
R0190:Vmn2r52 UTSW 7 10171388 missense probably benign 0.00
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0257:Vmn2r52 UTSW 7 10171055 nonsense probably null
R0310:Vmn2r52 UTSW 7 10159466 missense probably damaging 1.00
R1831:Vmn2r52 UTSW 7 10159488 missense probably damaging 1.00
R1862:Vmn2r52 UTSW 7 10173406 missense possibly damaging 0.94
R2484:Vmn2r52 UTSW 7 10169131 missense probably damaging 0.96
R2510:Vmn2r52 UTSW 7 10170868 missense probably benign
R3625:Vmn2r52 UTSW 7 10159178 missense probably damaging 1.00
R3803:Vmn2r52 UTSW 7 10173512 missense probably damaging 1.00
R4013:Vmn2r52 UTSW 7 10170676 missense probably benign 0.00
R4283:Vmn2r52 UTSW 7 10170638 missense possibly damaging 0.60
R4324:Vmn2r52 UTSW 7 10171013 missense possibly damaging 0.94
R4578:Vmn2r52 UTSW 7 10170690 missense probably damaging 1.00
R4806:Vmn2r52 UTSW 7 10159242 missense probably damaging 1.00
R5083:Vmn2r52 UTSW 7 10159465 nonsense probably null
R5249:Vmn2r52 UTSW 7 10176270 missense probably benign
R5306:Vmn2r52 UTSW 7 10170745 missense possibly damaging 0.88
R5332:Vmn2r52 UTSW 7 10169125 missense probably benign 0.17
R5617:Vmn2r52 UTSW 7 10170934 missense probably damaging 0.99
R5643:Vmn2r52 UTSW 7 10171132 missense probably damaging 1.00
R5749:Vmn2r52 UTSW 7 10159032 missense probably damaging 1.00
R5763:Vmn2r52 UTSW 7 10171304 missense probably benign 0.01
R6103:Vmn2r52 UTSW 7 10171400 missense probably benign 0.36
R6148:Vmn2r52 UTSW 7 10171163 missense probably benign 0.00
R6356:Vmn2r52 UTSW 7 10168999 missense probably benign 0.01
R6412:Vmn2r52 UTSW 7 10171009 missense probably benign
R6657:Vmn2r52 UTSW 7 10159163 missense probably damaging 0.99
R6997:Vmn2r52 UTSW 7 10169071 missense probably benign 0.06
R7395:Vmn2r52 UTSW 7 10170817 missense probably benign 0.00
R7621:Vmn2r52 UTSW 7 10173347 missense probably benign 0.00
R7691:Vmn2r52 UTSW 7 10159182 missense probably damaging 0.97
R7852:Vmn2r52 UTSW 7 10158968 missense probably damaging 1.00
R7908:Vmn2r52 UTSW 7 10162950 missense probably benign
R7909:Vmn2r52 UTSW 7 10162950 missense probably benign
R7912:Vmn2r52 UTSW 7 10162950 missense probably benign
R7913:Vmn2r52 UTSW 7 10162950 missense probably benign
R7993:Vmn2r52 UTSW 7 10162950 missense probably benign
R7994:Vmn2r52 UTSW 7 10162950 missense probably benign
Z1176:Vmn2r52 UTSW 7 10171200 missense probably damaging 0.97
Z1177:Vmn2r52 UTSW 7 10169190 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTACAGCAACCATGACCTTGC -3'
(R):5'- TGGCTTTCAAATTCACAGGC -3'

Sequencing Primer
(F):5'- GCCCTTTGTGCTATGGTAGAC -3'
(R):5'- GCTTTCAAATTCACAGGCCCAGG -3'
Posted On2019-12-27