Incidental Mutation 'R7935:Agmo'
ID612144
Institutional Source Beutler Lab
Gene Symbol Agmo
Ensembl Gene ENSMUSG00000050103
Gene Namealkylglycerol monooxygenase
SynonymsA530016O06Rik, Tmem195
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location37241641-37582202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37242052 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 4 (P4L)
Ref Sequence ENSEMBL: ENSMUSP00000051441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049874] [ENSMUST00000159998] [ENSMUST00000160390] [ENSMUST00000160768]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049874
AA Change: P4L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051441
Gene: ENSMUSG00000050103
AA Change: P4L

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 249 2.5e-29 PFAM
transmembrane domain 364 383 N/A INTRINSIC
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159998
AA Change: P4L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123801
Gene: ENSMUSG00000050103
AA Change: P4L

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160390
AA Change: P4L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125639
Gene: ENSMUSG00000050103
AA Change: P4L

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7.1e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160768
AA Change: P4L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124044
Gene: ENSMUSG00000050103
AA Change: P4L

DomainStartEndE-ValueType
transmembrane domain 43 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm4565 A G 7: 22,583,273 V40A possibly damaging Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Shmt2 G A 10: 127,519,331 probably null Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Agmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Agmo APN 12 37357717 missense probably damaging 1.00
IGL01412:Agmo APN 12 37402141 missense possibly damaging 0.49
IGL01682:Agmo APN 12 37357627 splice site probably benign
IGL02263:Agmo APN 12 37357697 missense probably damaging 1.00
IGL02478:Agmo APN 12 37401986 missense probably damaging 1.00
IGL02803:Agmo APN 12 37252481 missense probably benign 0.00
R0664:Agmo UTSW 12 37252572 missense probably damaging 1.00
R2158:Agmo UTSW 12 37357710 missense probably damaging 1.00
R3440:Agmo UTSW 12 37243800 missense probably damaging 1.00
R5263:Agmo UTSW 12 37357681 missense probably benign 0.01
R6249:Agmo UTSW 12 37243838 critical splice donor site probably null
R6251:Agmo UTSW 12 37252539 missense probably damaging 1.00
R7513:Agmo UTSW 12 37244353 missense probably benign 0.01
R7729:Agmo UTSW 12 37414975 missense probably benign 0.00
R7731:Agmo UTSW 12 37414940 missense probably benign 0.01
R7849:Agmo UTSW 12 37242045 missense probably benign 0.03
R7852:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R7932:Agmo UTSW 12 37242045 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAAACTCTGCTGTTGGCTG -3'
(R):5'- GCAAGCAAAGATGTAGATATTGTACCG -3'

Sequencing Primer
(F):5'- GGCTGAGGTCTCTGTGGATC -3'
(R):5'- TGTACCGAAGTTTGATTCACTTG -3'
Posted On2019-12-27