Incidental Mutation 'R7935:Ofcc1'
ID612148
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40180439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 392 (D392V)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably damaging
Transcript: ENSMUST00000054635
AA Change: D392V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: D392V

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224909
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm4565 A G 7: 22,583,273 V40A possibly damaging Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Shmt2 G A 10: 127,519,331 probably null Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
R7589:Ofcc1 UTSW 13 40255484 missense probably benign 0.13
R7792:Ofcc1 UTSW 13 40142826 missense probably damaging 0.99
R7852:Ofcc1 UTSW 13 40180439 missense probably damaging 1.00
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCACTCCAGGAAATACTTG -3'
(R):5'- TCCTCAAAGGAAAGCCGTG -3'

Sequencing Primer
(F):5'- GGCACTCCAGGAAATACTTGAAATTG -3'
(R):5'- AAAGCCGTGAAGCCTGGC -3'
Posted On2019-12-27