Incidental Mutation 'R0688:Gm4450'
ID61216
Institutional Source Beutler Lab
Gene Symbol Gm4450
Ensembl Gene ENSMUSG00000090817
Gene Namepredicted gene 4450
Synonyms
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0688 (G1)
Quality Score82
Status Not validated
Chromosome3
Chromosomal Location98445675-98457126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98456394 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 45 (E45G)
Ref Sequence ENSEMBL: ENSMUSP00000139967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167753] [ENSMUST00000188356]
Predicted Effect probably benign
Transcript: ENSMUST00000167753
AA Change: E45G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127882
Gene: ENSMUSG00000090817
AA Change: E45G

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 260 2.4e-9 PFAM
Pfam:KR 5 133 4.7e-8 PFAM
Pfam:Polysacc_synt_2 6 135 1.2e-12 PFAM
Pfam:NmrA 6 147 2.8e-12 PFAM
Pfam:Epimerase 6 249 2.7e-24 PFAM
Pfam:GDP_Man_Dehyd 7 218 8.6e-13 PFAM
Pfam:3Beta_HSD 7 288 2.4e-106 PFAM
Pfam:NAD_binding_4 8 225 5.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188356
AA Change: E45G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139967
Gene: ENSMUSG00000090817
AA Change: E45G

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 175 1.8e-6 PFAM
Pfam:adh_short 5 133 1.3e-8 PFAM
Pfam:KR 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 137 3.1e-11 PFAM
Pfam:NmrA 6 147 2.1e-10 PFAM
Pfam:NAD_binding_10 6 175 4e-12 PFAM
Pfam:Epimerase 6 191 1.6e-22 PFAM
Pfam:3Beta_HSD 7 191 1e-71 PFAM
Pfam:NAD_binding_4 8 191 4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Gm4450
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Gm4450 APN 3 98456400 missense probably benign
IGL02004:Gm4450 APN 3 98456419 missense probably damaging 1.00
R1301:Gm4450 UTSW 3 98446866 nonsense probably null
R2926:Gm4450 UTSW 3 98450556 splice site probably benign
R4797:Gm4450 UTSW 3 98456431 nonsense probably null
R4915:Gm4450 UTSW 3 98450529 missense probably damaging 0.97
R5796:Gm4450 UTSW 3 98446852 missense probably benign 0.00
R6479:Gm4450 UTSW 3 98446841 missense possibly damaging 0.79
R7085:Gm4450 UTSW 3 98450394 missense probably damaging 1.00
R8417:Gm4450 UTSW 3 98456415 missense probably benign 0.08
Z1176:Gm4450 UTSW 3 98456455 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATGACCAATTGTGGGTGAGGC -3'
(R):5'- GGCACAGACTAATGCAGTACCTCAG -3'

Sequencing Primer
(F):5'- TGTGCTGTTCCAGTTGTGAA -3'
(R):5'- TCCCACAAGATTTGGGATCAG -3'
Posted On2013-07-30