Incidental Mutation 'R7935:Lrfn2'
ID612161
Institutional Source Beutler Lab
Gene Symbol Lrfn2
Ensembl Gene ENSMUSG00000040490
Gene Nameleucine rich repeat and fibronectin type III domain containing 2
Synonyms5730420O05Rik, SALM1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location48932379-49097588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49069944 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 18 (V18I)
Ref Sequence ENSEMBL: ENSMUSP00000047573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046254
AA Change: V18I

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047573
Gene: ENSMUSG00000040490
AA Change: V18I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
LRRNT 20 56 2.9e0 SMART
LRR 75 98 7.36e0 SMART
LRR_TYP 99 122 1.1e-2 SMART
LRR_TYP 123 146 2.2e-2 SMART
LRR 148 171 4.45e1 SMART
LRR_TYP 172 195 1.56e-2 SMART
LRR 196 220 1.06e1 SMART
LRRCT 242 287 5.53e-4 SMART
IGc2 301 366 8e-12 SMART
low complexity region 401 415 N/A INTRINSIC
FN3 420 500 1.52e-1 SMART
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 613 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit small spleens, small or no thymi, impaired T cell development, and decreased T cell proliferation in response to mitogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm4565 A G 7: 22,583,273 V40A possibly damaging Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Shmt2 G A 10: 127,519,331 probably null Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Lrfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Lrfn2 APN 17 49070397 missense possibly damaging 0.81
IGL01989:Lrfn2 APN 17 49071085 missense probably damaging 1.00
IGL03324:Lrfn2 APN 17 49070887 missense probably damaging 1.00
IGL02991:Lrfn2 UTSW 17 49070704 missense probably damaging 1.00
R0306:Lrfn2 UTSW 17 49096255 missense probably damaging 0.99
R0539:Lrfn2 UTSW 17 49071044 missense probably damaging 1.00
R1245:Lrfn2 UTSW 17 49096249 critical splice acceptor site probably null
R1414:Lrfn2 UTSW 17 49070829 missense probably benign 0.01
R1437:Lrfn2 UTSW 17 49071225 missense probably damaging 0.97
R1670:Lrfn2 UTSW 17 49096577 missense probably benign 0.01
R2358:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3711:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3712:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R4521:Lrfn2 UTSW 17 49069894 start codon destroyed probably null 0.02
R4532:Lrfn2 UTSW 17 49070536 missense probably damaging 1.00
R4724:Lrfn2 UTSW 17 49070434 missense probably damaging 1.00
R5062:Lrfn2 UTSW 17 49070500 missense probably damaging 1.00
R5066:Lrfn2 UTSW 17 49096420 missense probably damaging 1.00
R5348:Lrfn2 UTSW 17 49096690 missense probably benign
R5673:Lrfn2 UTSW 17 49096597 missense probably benign 0.02
R5900:Lrfn2 UTSW 17 49070263 missense possibly damaging 0.82
R6014:Lrfn2 UTSW 17 49069906 missense possibly damaging 0.96
R6087:Lrfn2 UTSW 17 49071126 missense probably benign
R6224:Lrfn2 UTSW 17 49096351 missense probably damaging 1.00
R6229:Lrfn2 UTSW 17 49097132 missense possibly damaging 0.88
R6342:Lrfn2 UTSW 17 49097000 missense probably benign 0.27
R6408:Lrfn2 UTSW 17 49070626 missense probably damaging 1.00
R7026:Lrfn2 UTSW 17 49096977 missense probably benign 0.00
R7505:Lrfn2 UTSW 17 49096451 missense probably benign 0.14
R7852:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
Z1177:Lrfn2 UTSW 17 49070012 frame shift probably null
Z1177:Lrfn2 UTSW 17 49070095 missense probably benign 0.03
Z1177:Lrfn2 UTSW 17 49096715 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCATAGCCTGTCTCTGTTG -3'
(R):5'- GCTGATGGTGTTCCTGGACAAG -3'

Sequencing Primer
(F):5'- GTTCCCCGGTGGAGTGTGAC -3'
(R):5'- AGCCCTGTCATGTTGGCAAAG -3'
Posted On2019-12-27