Incidental Mutation 'R0688:Gm13083'
ID61223
Institutional Source Beutler Lab
Gene Symbol Gm13083
Ensembl Gene ENSMUSG00000066688
Gene Namepredicted gene 13083
Synonyms
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0688 (G1)
Quality Score154
Status Not validated
Chromosome4
Chromosomal Location143615003-143618595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143617357 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 409 (F409S)
Ref Sequence ENSEMBL: ENSMUSP00000101399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105773]
Predicted Effect probably benign
Transcript: ENSMUST00000105773
AA Change: F409S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101399
Gene: ENSMUSG00000066688
AA Change: F409S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 431 7e-12 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Gm13083
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Gm13083 APN 4 143615073 missense probably benign 0.00
IGL02390:Gm13083 APN 4 143615325 missense probably benign 0.29
IGL02676:Gm13083 APN 4 143616097 missense possibly damaging 0.75
IGL03381:Gm13083 APN 4 143617055 splice site probably benign
IGL03410:Gm13083 APN 4 143615281 missense probably benign 0.02
H8562:Gm13083 UTSW 4 143615350 splice site probably benign
PIT4151001:Gm13083 UTSW 4 143616152 nonsense probably null
R0157:Gm13083 UTSW 4 143615796 missense probably damaging 0.98
R0352:Gm13083 UTSW 4 143615989 missense possibly damaging 0.92
R0494:Gm13083 UTSW 4 143616156 missense probably benign 0.33
R0884:Gm13083 UTSW 4 143615184 missense probably benign 0.01
R1267:Gm13083 UTSW 4 143615734 missense possibly damaging 0.95
R1418:Gm13083 UTSW 4 143616034 missense probably benign 0.15
R1761:Gm13083 UTSW 4 143615868 missense probably benign 0.00
R3148:Gm13083 UTSW 4 143617477 missense probably benign 0.30
R4063:Gm13083 UTSW 4 143615989 missense possibly damaging 0.77
R4115:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R4760:Gm13083 UTSW 4 143617231 missense probably benign 0.04
R5516:Gm13083 UTSW 4 143615683 missense possibly damaging 0.49
R5603:Gm13083 UTSW 4 143617496 nonsense probably null
R5724:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R5796:Gm13083 UTSW 4 143615208 missense probably benign 0.12
R5879:Gm13083 UTSW 4 143617591 missense possibly damaging 0.64
R6181:Gm13083 UTSW 4 143616258 critical splice donor site probably null
R7155:Gm13083 UTSW 4 143616165 missense probably benign 0.01
R7492:Gm13083 UTSW 4 143616174 missense not run
Z1088:Gm13083 UTSW 4 143615232 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTATCTTTCCCAGTGTCCAAGCACC -3'
(R):5'- AGACCTGCTTTGGCTGCCTTAC -3'

Sequencing Primer
(F):5'- CTCAAACACCTGGATCTGAGTGG -3'
(R):5'- TGCCTTACACCCTTGAGTG -3'
Posted On2013-07-30