Incidental Mutation 'R7936:Myo1f'
ID612243
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7936 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33576698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 106 (V106D)
Ref Sequence ENSEMBL: ENSMUSP00000084887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372] [ENSMUST00000174695]
Predicted Effect probably damaging
Transcript: ENSMUST00000087605
AA Change: V106D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: V106D

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173372
AA Change: V106D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: V106D

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174695
AA Change: V76D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134600
Gene: ENSMUSG00000024300
AA Change: V76D

DomainStartEndE-ValueType
Pfam:Myosin_head 47 98 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Akap13 T A 7: 75,615,073 probably null Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Pard3b C A 1: 61,767,945 probably null Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Pxt1 G T 17: 28,941,376 probably null Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7606:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
R7967:Myo1f UTSW 17 33598296 missense probably damaging 1.00
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAACCCCTTCAAGCAGATGC -3'
(R):5'- GAACAAATATACTGATTCAGGAGCC -3'

Sequencing Primer
(F):5'- TGACCGAGAAATTGACCTCTATCAG -3'
(R):5'- TATACTGATTCAGGAGCCAAGAG -3'
Posted On2019-12-27