Incidental Mutation 'R7937:Trpa1'
ID612249
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14881694 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 927 (E927G)
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect probably benign
Transcript: ENSMUST00000041447
AA Change: E927G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: E927G

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,112,377 Y48F probably benign Het
Adgrv1 T A 13: 81,593,088 I86F probably damaging Het
Aes A G 10: 81,565,647 H183R probably damaging Het
Als2cl A G 9: 110,898,496 *953W probably null Het
Ap1g2 A G 14: 55,105,933 F66L probably damaging Het
Aqp12 T G 1: 93,006,454 C18G probably damaging Het
Atp9a T C 2: 168,648,603 I826V probably benign Het
C1ra A G 6: 124,517,741 Q321R probably benign Het
Calcoco1 T C 15: 102,719,556 I48V possibly damaging Het
Cep63 A T 9: 102,602,998 S269R probably damaging Het
Chchd7 T C 4: 3,943,422 V63A possibly damaging Het
Dennd5b T C 6: 149,068,466 D163G probably benign Het
Dpep2 T C 8: 105,989,528 D251G Het
Ercc6 T C 14: 32,566,292 L807P probably damaging Het
Fads6 A T 11: 115,297,396 D27E probably benign Het
Glce A T 9: 62,070,491 I37N probably benign Het
Gps2 T C 11: 69,915,204 L128P probably damaging Het
Gramd3 A G 18: 56,478,854 T130A probably damaging Het
Hectd4 T A 5: 121,329,568 Y2527N probably benign Het
Itpr1 A G 6: 108,387,369 D820G probably damaging Het
Itsn2 T C 12: 4,701,276 Y1289H probably damaging Het
Kcnh6 A T 11: 106,017,346 I263F probably damaging Het
Kcns2 A T 15: 34,839,771 M427L probably benign Het
Mptx1 A T 1: 174,332,400 M91L probably benign Het
Mtx2 A G 2: 74,868,887 Y128C probably damaging Het
Myh9 A T 15: 77,791,753 D244E probably benign Het
Ndufs2 T C 1: 171,239,369 D140G probably damaging Het
Obscn T C 11: 59,090,712 T1827A probably benign Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr356 A G 2: 36,938,024 R302G probably benign Het
Olfr568 C T 7: 102,877,785 R222* probably null Het
Parp4 A G 14: 56,659,348 E1943G unknown Het
Pex19 T G 1: 172,126,850 probably null Het
Prss53 T C 7: 127,888,945 N166S probably benign Het
Prx T A 7: 27,516,641 V328E probably damaging Het
Pstpip2 C T 18: 77,874,304 T258I probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Ros1 T C 10: 52,128,467 Y1019C probably damaging Het
Rptor T C 11: 119,857,953 M787T probably benign Het
Spef2 T A 15: 9,596,644 R1440W possibly damaging Het
Spta1 T A 1: 174,218,830 probably null Het
Sptbn4 T C 7: 27,362,410 I2335V probably benign Het
Taar1 A G 10: 23,920,782 D126G probably benign Het
Tdrd9 A G 12: 112,046,961 T1210A probably benign Het
Tpcn1 A G 5: 120,549,588 F364L probably damaging Het
Trav2 A T 14: 52,567,781 K20* probably null Het
Tyk2 A T 9: 21,115,480 D637E probably benign Het
Vmn1r200 T C 13: 22,395,839 F271L probably benign Het
Vmn1r231 T A 17: 20,890,632 D7V probably damaging Het
Wwc2 G A 8: 47,868,477 T534I unknown Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7412:Trpa1 UTSW 1 14884198 missense probably benign 0.43
R7639:Trpa1 UTSW 1 14886913 missense probably benign 0.00
R7740:Trpa1 UTSW 1 14912401 missense possibly damaging 0.72
R7815:Trpa1 UTSW 1 14904262 missense probably benign 0.01
R7854:Trpa1 UTSW 1 14881694 missense probably benign 0.00
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Z1176:Trpa1 UTSW 1 14881692 missense probably damaging 1.00
Z1176:Trpa1 UTSW 1 14891306 missense possibly damaging 0.80
Z1176:Trpa1 UTSW 1 14898350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAGATGTAGGCCAGTTAGAG -3'
(R):5'- GGAGCTGCATGTGTGAATTAAATTC -3'

Sequencing Primer
(F):5'- TGGATGCCATTCCTCTGGACAAG -3'
(R):5'- CTTAGCATAATTTGACCACCAGG -3'
Posted On2019-12-27