Incidental Mutation 'R7937:Ndufs2'
ID612251
Institutional Source Beutler Lab
Gene Symbol Ndufs2
Ensembl Gene ENSMUSG00000013593
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171234853-171251388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171239369 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000013737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013737] [ENSMUST00000111318] [ENSMUST00000191871] [ENSMUST00000194778]
Predicted Effect probably damaging
Transcript: ENSMUST00000013737
AA Change: D140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593
AA Change: D140G

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111318
AA Change: D140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593
AA Change: D140G

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191871
AA Change: D61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593
AA Change: D61G

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194778
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593
AA Change: D113G

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,112,377 Y48F probably benign Het
Adgrv1 T A 13: 81,593,088 I86F probably damaging Het
Aes A G 10: 81,565,647 H183R probably damaging Het
Als2cl A G 9: 110,898,496 *953W probably null Het
Ap1g2 A G 14: 55,105,933 F66L probably damaging Het
Aqp12 T G 1: 93,006,454 C18G probably damaging Het
Atp9a T C 2: 168,648,603 I826V probably benign Het
C1ra A G 6: 124,517,741 Q321R probably benign Het
Calcoco1 T C 15: 102,719,556 I48V possibly damaging Het
Cep63 A T 9: 102,602,998 S269R probably damaging Het
Chchd7 T C 4: 3,943,422 V63A possibly damaging Het
Dennd5b T C 6: 149,068,466 D163G probably benign Het
Dpep2 T C 8: 105,989,528 D251G Het
Ercc6 T C 14: 32,566,292 L807P probably damaging Het
Fads6 A T 11: 115,297,396 D27E probably benign Het
Glce A T 9: 62,070,491 I37N probably benign Het
Gps2 T C 11: 69,915,204 L128P probably damaging Het
Gramd3 A G 18: 56,478,854 T130A probably damaging Het
Hectd4 T A 5: 121,329,568 Y2527N probably benign Het
Itpr1 A G 6: 108,387,369 D820G probably damaging Het
Itsn2 T C 12: 4,701,276 Y1289H probably damaging Het
Kcnh6 A T 11: 106,017,346 I263F probably damaging Het
Kcns2 A T 15: 34,839,771 M427L probably benign Het
Mptx1 A T 1: 174,332,400 M91L probably benign Het
Mtx2 A G 2: 74,868,887 Y128C probably damaging Het
Myh9 A T 15: 77,791,753 D244E probably benign Het
Obscn T C 11: 59,090,712 T1827A probably benign Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr356 A G 2: 36,938,024 R302G probably benign Het
Olfr568 C T 7: 102,877,785 R222* probably null Het
Parp4 A G 14: 56,659,348 E1943G unknown Het
Pex19 T G 1: 172,126,850 probably null Het
Prss53 T C 7: 127,888,945 N166S probably benign Het
Prx T A 7: 27,516,641 V328E probably damaging Het
Pstpip2 C T 18: 77,874,304 T258I probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Ros1 T C 10: 52,128,467 Y1019C probably damaging Het
Rptor T C 11: 119,857,953 M787T probably benign Het
Spef2 T A 15: 9,596,644 R1440W possibly damaging Het
Spta1 T A 1: 174,218,830 probably null Het
Sptbn4 T C 7: 27,362,410 I2335V probably benign Het
Taar1 A G 10: 23,920,782 D126G probably benign Het
Tdrd9 A G 12: 112,046,961 T1210A probably benign Het
Tpcn1 A G 5: 120,549,588 F364L probably damaging Het
Trav2 A T 14: 52,567,781 K20* probably null Het
Trpa1 T C 1: 14,881,694 E927G probably benign Het
Tyk2 A T 9: 21,115,480 D637E probably benign Het
Vmn1r200 T C 13: 22,395,839 F271L probably benign Het
Vmn1r231 T A 17: 20,890,632 D7V probably damaging Het
Wwc2 G A 8: 47,868,477 T534I unknown Het
Other mutations in Ndufs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Ndufs2 APN 1 171237229 missense probably benign 0.45
IGL02367:Ndufs2 APN 1 171239365 nonsense probably null
R0905:Ndufs2 UTSW 1 171236353 unclassified probably null
R1618:Ndufs2 UTSW 1 171246121 missense probably benign 0.19
R3788:Ndufs2 UTSW 1 171235320 missense possibly damaging 0.81
R4866:Ndufs2 UTSW 1 171247049 missense probably benign 0.05
R4959:Ndufs2 UTSW 1 171238009 missense probably damaging 1.00
R5788:Ndufs2 UTSW 1 171239385 missense probably damaging 1.00
R5992:Ndufs2 UTSW 1 171236418 missense probably damaging 1.00
R6141:Ndufs2 UTSW 1 171236616 missense probably damaging 1.00
R6419:Ndufs2 UTSW 1 171241099 missense probably benign 0.12
R6480:Ndufs2 UTSW 1 171236698 missense probably damaging 1.00
R7034:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7036:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7854:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R8023:Ndufs2 UTSW 1 171236694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGCTCATCGTACAGATCATTC -3'
(R):5'- CGCTAGTCTTAAATCATCATGGTAG -3'

Sequencing Primer
(F):5'- GGGTAGAATCTGGAATCTAAACATC -3'
(R):5'- AGTGATTTTGGGGACATTTCATCC -3'
Posted On2019-12-27