Incidental Mutation 'R7937:Olfr568'
ID612267
Institutional Source Beutler Lab
Gene Symbol Olfr568
Ensembl Gene ENSMUSG00000073965
Gene Nameolfactory receptor 568
SynonymsMOR14-3, MOR14-11, GA_x6K02T2PBJ9-5588278-5589228
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102877122-102878063 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 102877785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 222 (R222*)
Ref Sequence ENSEMBL: ENSMUSP00000095818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098216]
Predicted Effect probably null
Transcript: ENSMUST00000098216
AA Change: R222*
SMART Domains Protein: ENSMUSP00000095818
Gene: ENSMUSG00000073965
AA Change: R222*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.6e-113 PFAM
Pfam:7TM_GPCR_Srsx 34 306 1.8e-7 PFAM
Pfam:7tm_1 40 291 1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,112,377 Y48F probably benign Het
Adgrv1 T A 13: 81,593,088 I86F probably damaging Het
Aes A G 10: 81,565,647 H183R probably damaging Het
Als2cl A G 9: 110,898,496 *953W probably null Het
Ap1g2 A G 14: 55,105,933 F66L probably damaging Het
Aqp12 T G 1: 93,006,454 C18G probably damaging Het
Atp9a T C 2: 168,648,603 I826V probably benign Het
C1ra A G 6: 124,517,741 Q321R probably benign Het
Calcoco1 T C 15: 102,719,556 I48V possibly damaging Het
Cep63 A T 9: 102,602,998 S269R probably damaging Het
Chchd7 T C 4: 3,943,422 V63A possibly damaging Het
Dennd5b T C 6: 149,068,466 D163G probably benign Het
Dpep2 T C 8: 105,989,528 D251G Het
Ercc6 T C 14: 32,566,292 L807P probably damaging Het
Fads6 A T 11: 115,297,396 D27E probably benign Het
Glce A T 9: 62,070,491 I37N probably benign Het
Gps2 T C 11: 69,915,204 L128P probably damaging Het
Gramd3 A G 18: 56,478,854 T130A probably damaging Het
Hectd4 T A 5: 121,329,568 Y2527N probably benign Het
Itpr1 A G 6: 108,387,369 D820G probably damaging Het
Itsn2 T C 12: 4,701,276 Y1289H probably damaging Het
Kcnh6 A T 11: 106,017,346 I263F probably damaging Het
Kcns2 A T 15: 34,839,771 M427L probably benign Het
Mptx1 A T 1: 174,332,400 M91L probably benign Het
Mtx2 A G 2: 74,868,887 Y128C probably damaging Het
Myh9 A T 15: 77,791,753 D244E probably benign Het
Ndufs2 T C 1: 171,239,369 D140G probably damaging Het
Obscn T C 11: 59,090,712 T1827A probably benign Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr356 A G 2: 36,938,024 R302G probably benign Het
Parp4 A G 14: 56,659,348 E1943G unknown Het
Pex19 T G 1: 172,126,850 probably null Het
Prss53 T C 7: 127,888,945 N166S probably benign Het
Prx T A 7: 27,516,641 V328E probably damaging Het
Pstpip2 C T 18: 77,874,304 T258I probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Ros1 T C 10: 52,128,467 Y1019C probably damaging Het
Rptor T C 11: 119,857,953 M787T probably benign Het
Spef2 T A 15: 9,596,644 R1440W possibly damaging Het
Spta1 T A 1: 174,218,830 probably null Het
Sptbn4 T C 7: 27,362,410 I2335V probably benign Het
Taar1 A G 10: 23,920,782 D126G probably benign Het
Tdrd9 A G 12: 112,046,961 T1210A probably benign Het
Tpcn1 A G 5: 120,549,588 F364L probably damaging Het
Trav2 A T 14: 52,567,781 K20* probably null Het
Trpa1 T C 1: 14,881,694 E927G probably benign Het
Tyk2 A T 9: 21,115,480 D637E probably benign Het
Vmn1r200 T C 13: 22,395,839 F271L probably benign Het
Vmn1r231 T A 17: 20,890,632 D7V probably damaging Het
Wwc2 G A 8: 47,868,477 T534I unknown Het
Other mutations in Olfr568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Olfr568 APN 7 102877233 missense probably benign 0.02
IGL02349:Olfr568 APN 7 102877909 missense probably benign 0.06
IGL02421:Olfr568 APN 7 102877759 missense probably damaging 1.00
IGL03179:Olfr568 APN 7 102878072 unclassified probably benign
FR4737:Olfr568 UTSW 7 102877233 small insertion probably benign
R0003:Olfr568 UTSW 7 102877861 missense probably benign 0.02
R0126:Olfr568 UTSW 7 102877140 missense probably benign 0.25
R1435:Olfr568 UTSW 7 102877767 missense probably damaging 1.00
R1585:Olfr568 UTSW 7 102877773 missense probably benign 0.00
R1660:Olfr568 UTSW 7 102877656 missense probably damaging 1.00
R1678:Olfr568 UTSW 7 102877663 missense probably damaging 1.00
R2010:Olfr568 UTSW 7 102877685 nonsense probably null
R4706:Olfr568 UTSW 7 102877433 missense probably damaging 1.00
R5490:Olfr568 UTSW 7 102877893 missense probably damaging 1.00
R5632:Olfr568 UTSW 7 102877797 missense probably benign 0.00
R6370:Olfr568 UTSW 7 102877170 missense probably benign 0.43
R6675:Olfr568 UTSW 7 102877273 missense possibly damaging 0.89
R7854:Olfr568 UTSW 7 102877785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCAGGATTGCCCAGATTG -3'
(R):5'- AGGAAGACGTTGGCCATGAC -3'

Sequencing Primer
(F):5'- TGCCGTCATGTTGCCAG -3'
(R):5'- TGGCCATGACGGTGTGGAC -3'
Posted On2019-12-27