Mutagenetix > Incidental Mutations

Incidental Mutation 'R0688:Bicra'

61230

Institutional Source

Beutler Lab

Gene Symbol

Bicra

Ensembl Gene

ENSMUSG00000070808

Gene Name

BRD4 interacting chromatin remodeling complex associated protein

Synonyms

Gltscr1

MMRRC Submission

038873-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R0688 (G1)

Quality Score

158

Status

Not validated

Chromosome

Chromosomal Location

15970672-16047921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15989322 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 90 (G90D)

Ref Sequence

ENSEMBL: ENSMUSP00000148012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094821
AA Change: G90D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: G90D

Domain	Start	End	E-Value	Type
low complexity region	86	96	N/A	INTRINSIC
low complexity region	140	155	N/A	INTRINSIC
internal_repeat_1	156	298	1.03e-6	PROSPERO
low complexity region	308	323	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
internal_repeat_1	479	614	1.03e-6	PROSPERO
low complexity region	619	638	N/A	INTRINSIC
low complexity region	642	676	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	756	782	N/A	INTRINSIC
low complexity region	790	819	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	852	906	N/A	INTRINSIC
low complexity region	940	950	N/A	INTRINSIC
low complexity region	987	1006	N/A	INTRINSIC
Pfam:GLTSCR1	1094	1202	4.6e-43	PFAM
low complexity region	1232	1251	N/A	INTRINSIC
low complexity region	1275	1294	N/A	INTRINSIC
low complexity region	1349	1371	N/A	INTRINSIC
low complexity region	1460	1473	N/A	INTRINSIC
low complexity region	1535	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210713

Predicted Effect

probably damaging
Transcript: ENSMUST00000210781
AA Change: G90D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad11	T	G	9: 104,124,100	V615G	probably damaging	Het
Apaf1	T	G	10: 91,061,705	E305D	possibly damaging	Het
Apol10b	A	G	15: 77,585,219	S253P	probably damaging	Het
Bbs9	T	A	9: 22,567,719	C153S	probably damaging	Het
Clca4a	A	C	3: 144,961,974	L412R	probably damaging	Het
Cul3	A	T	1: 80,271,564	D597E	possibly damaging	Het
Cxcr5	A	G	9: 44,513,667		probably null	Het
Dnah10	T	C	5: 124,747,718	I646T	possibly damaging	Het
Focad	T	A	4: 88,274,213	V593D	unknown	Het
Fsip2	T	A	2: 82,982,339	S3001T	probably benign	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gdf9	T	A	11: 53,436,640	L141Q	probably damaging	Het
Gm13083	T	C	4: 143,617,357	F409S	probably benign	Het
Gm4450	T	C	3: 98,456,394	E45G	probably benign	Het
Gpr180	A	G	14: 118,148,184	D136G	probably benign	Het
Itga2	G	T	13: 114,839,554	A1094E	probably benign	Het
Ly75	C	T	2: 60,316,221	A1238T	probably benign	Het
Macc1	T	C	12: 119,447,003	V502A	probably damaging	Het
Mroh4	T	C	15: 74,606,678	K923E	probably damaging	Het
Msh3	G	A	13: 92,351,431	P93S	possibly damaging	Het
Myo18a	A	G	11: 77,824,140	D474G	probably damaging	Het
Npat	T	A	9: 53,570,222	Y1077N	probably benign	Het
Olfr1214	A	T	2: 88,987,595	S202R	probably damaging	Het
Olfr427	A	C	1: 174,100,064	H202P	probably damaging	Het
Olfr52	A	T	2: 86,181,605		probably null	Het
Olfr816	T	G	10: 129,911,883	T132P	probably damaging	Het
Paqr5	T	G	9: 61,972,794	T59P	probably benign	Het
Phyhipl	C	T	10: 70,559,255	G329R	probably damaging	Het
Pomgnt1	T	C	4: 116,155,889	Y430H	probably damaging	Het
Prkd3	A	T	17: 78,957,233	M651K	probably damaging	Het
Puf60	A	T	15: 76,070,774	M440K	probably damaging	Het
Recql4	A	G	15: 76,709,809		probably null	Het
Sgk1	A	C	10: 21,998,160	M320L	probably benign	Het
Slc27a4	T	C	2: 29,812,615	F509S	probably damaging	Het
Sorbs1	T	C	19: 40,363,262	T235A	probably damaging	Het
Srrm3	A	G	5: 135,869,276		probably benign	Het
Tex15	C	T	8: 33,573,500	T986I	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Zswim4	T	C	8: 84,228,888	M301V	possibly damaging	Het

Other mutations in Bicra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Bicra	APN	7	15996577	missense	possibly damaging	0.70
IGL01521:Bicra	APN	7	15989188	missense	probably benign	0.18
IGL01690:Bicra	APN	7	15987753	missense	probably benign	0.09
IGL01721:Bicra	APN	7	15988699	missense	probably benign
IGL01994:Bicra	APN	7	15972816	missense	possibly damaging	0.46
IGL02084:Bicra	APN	7	15987738	missense	probably benign	0.09
IGL02312:Bicra	APN	7	15993141	missense	possibly damaging	0.85
IGL02686:Bicra	APN	7	15987915	missense	probably benign	0.02
IGL02727:Bicra	APN	7	15979465	missense	possibly damaging	0.95
IGL03031:Bicra	APN	7	15975801	missense	probably benign	0.16
R0003:Bicra	UTSW	7	15971887	missense	probably benign
R0025:Bicra	UTSW	7	15987511	missense	possibly damaging	0.53
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0417:Bicra	UTSW	7	15972322	missense	probably damaging	1.00
R0437:Bicra	UTSW	7	15988762	missense	possibly damaging	0.73
R0547:Bicra	UTSW	7	15972248	missense	probably damaging	1.00
R0855:Bicra	UTSW	7	15972004	missense	probably damaging	1.00
R1448:Bicra	UTSW	7	15988359	missense	possibly damaging	0.86
R1637:Bicra	UTSW	7	15972689	missense	probably benign	0.19
R1899:Bicra	UTSW	7	15987751	missense	possibly damaging	0.53
R2035:Bicra	UTSW	7	15996413	missense	possibly damaging	0.53
R2247:Bicra	UTSW	7	15989234	missense	probably benign	0.33
R2471:Bicra	UTSW	7	15972332	missense	probably benign	0.04
R2484:Bicra	UTSW	7	15988680	missense	possibly damaging	0.96
R3437:Bicra	UTSW	7	15989298	missense	possibly damaging	0.85
R3551:Bicra	UTSW	7	15979733	missense	probably benign	0.33
R4816:Bicra	UTSW	7	15988906	missense	possibly damaging	0.53
R4901:Bicra	UTSW	7	15987601	missense	possibly damaging	0.53
R5035:Bicra	UTSW	7	15979424	missense	possibly damaging	0.90
R5078:Bicra	UTSW	7	15975457	missense	probably damaging	1.00
R5094:Bicra	UTSW	7	15975371	missense	probably damaging	1.00
R5195:Bicra	UTSW	7	15979953	missense	possibly damaging	0.93
R5496:Bicra	UTSW	7	15987841	missense	probably benign	0.33
R5780:Bicra	UTSW	7	15979754	missense	possibly damaging	0.96
R6541:Bicra	UTSW	7	15979129	missense	probably benign	0.00
R6560:Bicra	UTSW	7	15989194	missense	possibly damaging	0.53
R6575:Bicra	UTSW	7	15979131	missense	probably benign	0.25
R6854:Bicra	UTSW	7	15988762	missense	probably benign	0.18
R6967:Bicra	UTSW	7	15972205	missense	probably damaging	0.97
R7283:Bicra	UTSW	7	15972500	missense	probably damaging	1.00
R7454:Bicra	UTSW	7	15972134	missense	probably benign	0.30
R7462:Bicra	UTSW	7	15979135	missense	possibly damaging	0.84
R7488:Bicra	UTSW	7	15989442	critical splice acceptor site	probably null
R7506:Bicra	UTSW	7	15988213	missense	possibly damaging	0.96
R7534:Bicra	UTSW	7	15971935	missense	probably damaging	0.98
R7915:Bicra	UTSW	7	15988522	missense	probably benign
R8063:Bicra	UTSW	7	15979044	missense	probably benign
R8147:Bicra	UTSW	7	15988470	missense	possibly damaging	0.93
X0064:Bicra	UTSW	7	15975775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATTCCCAGGACTGCCATTG -3'
(R):5'- GAGACAGAGTGTCCCTTTGTTGACC -3'

Sequencing Primer
(F):5'- TGAAGGGTCACATTGCCCAG -3'
(R):5'- GTTGACCTCAGCTCTTGCC -3'

Posted On

2013-07-30