Incidental Mutation 'R7938:Nup160'
ID612308
Institutional Source Beutler Lab
Gene Symbol Nup160
Ensembl Gene ENSMUSG00000051329
Gene Namenucleoporin 160
SynonymsGtl1-13, 2810011M03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7938 (G1)
Quality Score113.008
Status Not validated
Chromosome2
Chromosomal Location90677215-90736328 bp(+) (GRCm38)
Type of Mutationintron (165 bp from exon)
DNA Base Change (assembly) T to A at 90702711 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057481]
Predicted Effect probably null
Transcript: ENSMUST00000057481
SMART Domains Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329

DomainStartEndE-ValueType
Pfam:Nup160 28 543 9.9e-134 PFAM
low complexity region 695 710 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1302 1315 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm13723 C A 2: 86,873,262 V154L probably benign Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Nup160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nup160 APN 2 90693106 missense probably damaging 1.00
IGL00938:Nup160 APN 2 90732827 missense probably damaging 1.00
IGL01111:Nup160 APN 2 90733209 missense probably benign 0.00
IGL01140:Nup160 APN 2 90700565 missense possibly damaging 0.85
IGL01348:Nup160 APN 2 90700428 missense probably benign 0.05
IGL01361:Nup160 APN 2 90684012 nonsense probably null
IGL01595:Nup160 APN 2 90729737 missense probably damaging 1.00
IGL01791:Nup160 APN 2 90703853 missense probably damaging 1.00
IGL02058:Nup160 APN 2 90729707 missense probably damaging 1.00
IGL02147:Nup160 APN 2 90703941 missense probably benign 0.17
IGL02250:Nup160 APN 2 90708870 missense probably damaging 1.00
IGL02507:Nup160 APN 2 90729735 missense probably benign 0.08
IGL03108:Nup160 APN 2 90703825 missense probably benign
R0031:Nup160 UTSW 2 90717587 splice site probably null
R0365:Nup160 UTSW 2 90708844 missense probably benign 0.01
R0417:Nup160 UTSW 2 90735427 missense possibly damaging 0.93
R0781:Nup160 UTSW 2 90733219 splice site probably benign
R1037:Nup160 UTSW 2 90693902 missense probably damaging 1.00
R1110:Nup160 UTSW 2 90733219 splice site probably benign
R1459:Nup160 UTSW 2 90690150 missense probably damaging 1.00
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1478:Nup160 UTSW 2 90679399 start gained probably benign
R1565:Nup160 UTSW 2 90722061 missense possibly damaging 0.62
R1617:Nup160 UTSW 2 90679499 missense probably benign
R1647:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1648:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1702:Nup160 UTSW 2 90683958 missense probably damaging 0.96
R1719:Nup160 UTSW 2 90700436 nonsense probably null
R2448:Nup160 UTSW 2 90722057 missense probably damaging 1.00
R3775:Nup160 UTSW 2 90722076 missense probably benign
R3776:Nup160 UTSW 2 90722076 missense probably benign
R4600:Nup160 UTSW 2 90685197 critical splice donor site probably null
R4812:Nup160 UTSW 2 90725691 missense probably damaging 1.00
R5075:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R5309:Nup160 UTSW 2 90732832 nonsense probably null
R5312:Nup160 UTSW 2 90732832 nonsense probably null
R5447:Nup160 UTSW 2 90725615 missense possibly damaging 0.82
R5682:Nup160 UTSW 2 90679811 missense probably benign 0.29
R5726:Nup160 UTSW 2 90717851 missense probably damaging 1.00
R5771:Nup160 UTSW 2 90723396 missense probably damaging 1.00
R5825:Nup160 UTSW 2 90679770 critical splice acceptor site probably null
R5851:Nup160 UTSW 2 90707038 missense probably benign
R5988:Nup160 UTSW 2 90689209 missense probably damaging 1.00
R6151:Nup160 UTSW 2 90690105 nonsense probably null
R6164:Nup160 UTSW 2 90717876 nonsense probably null
R6356:Nup160 UTSW 2 90711935 splice site probably null
R6379:Nup160 UTSW 2 90702409 nonsense probably null
R6519:Nup160 UTSW 2 90718217 missense probably damaging 0.99
R6755:Nup160 UTSW 2 90700456 missense probably damaging 1.00
R6989:Nup160 UTSW 2 90707020 missense probably benign 0.34
R7251:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R7256:Nup160 UTSW 2 90723355 missense probably damaging 1.00
R7353:Nup160 UTSW 2 90703952 missense probably damaging 0.99
R7546:Nup160 UTSW 2 90685058 missense probably damaging 1.00
R7761:Nup160 UTSW 2 90703112 missense probably benign
R7768:Nup160 UTSW 2 90700116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGAACACATTTTGGAAG -3'
(R):5'- GGCACAAGACACTCAGAGTC -3'

Sequencing Primer
(F):5'- GCGGAACACATTTTGGAAGATTTG -3'
(R):5'- AAACAGGGGCTTCAGAGT -3'
Posted On2019-12-27