Incidental Mutation 'R7938:Cd38'
ID612313
Institutional Source Beutler Lab
Gene Symbol Cd38
Ensembl Gene ENSMUSG00000029084
Gene NameCD38 antigen
SynonymsCd38-rs1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location43868553-43912375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43901448 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 135 (L135M)
Ref Sequence ENSEMBL: ENSMUSP00000030964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030964]
PDB Structure
Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030964
AA Change: L135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084
AA Change: L135M

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Rib_hydrolayse 59 300 2.9e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm13723 C A 2: 86,873,262 V154L probably benign Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Nup160 T A 2: 90,702,711 probably null Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Cd38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Cd38 APN 5 43903597 missense probably benign 0.04
IGL01691:Cd38 APN 5 43903586 splice site probably benign
IGL02585:Cd38 APN 5 43910302 missense probably damaging 1.00
paradiso UTSW 5 43903585 splice site probably null
IGL02796:Cd38 UTSW 5 43906213 missense probably damaging 1.00
R0496:Cd38 UTSW 5 43868891 missense probably damaging 1.00
R0855:Cd38 UTSW 5 43903585 splice site probably null
R1621:Cd38 UTSW 5 43901524 missense probably benign 0.00
R2353:Cd38 UTSW 5 43908011 critical splice donor site probably null
R2366:Cd38 UTSW 5 43903590 splice site probably benign
R2860:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R2861:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R4342:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4343:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4344:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4953:Cd38 UTSW 5 43907545 missense possibly damaging 0.73
R5007:Cd38 UTSW 5 43906164 missense probably damaging 1.00
R5371:Cd38 UTSW 5 43868883 missense probably benign 0.01
R5699:Cd38 UTSW 5 43900386 missense probably damaging 1.00
R6857:Cd38 UTSW 5 43906198 missense probably damaging 0.99
R6945:Cd38 UTSW 5 43908006 missense probably damaging 1.00
R7129:Cd38 UTSW 5 43910309 missense probably benign 0.13
R7825:Cd38 UTSW 5 43901455 missense probably damaging 1.00
R7852:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7855:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7894:Cd38 UTSW 5 43900404 missense probably damaging 1.00
R7935:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7977:Cd38 UTSW 5 43900404 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGTAGACAATAGCAAAACTG -3'
(R):5'- AGTTCCCTTGCAGCTCAAAGC -3'

Sequencing Primer
(F):5'- AGTGCATGTCATTTATTCTGATGG -3'
(R):5'- GCTCAAAGCTCCCTTCCCAC -3'
Posted On2019-12-27