Incidental Mutation 'R7938:Coro1c'
ID612314
Institutional Source Beutler Lab
Gene Symbol Coro1c
Ensembl Gene ENSMUSG00000004530
Gene Namecoronin, actin binding protein 1C
Synonymscoronin 3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location113842436-113908758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113848597 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 262 (M262K)
Ref Sequence ENSEMBL: ENSMUSP00000004646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004646] [ENSMUST00000164980]
Predicted Effect probably benign
Transcript: ENSMUST00000004646
AA Change: M262K

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004646
Gene: ENSMUSG00000004530
AA Change: M262K

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
WD40 119 159 1.09e-5 SMART
WD40 162 202 3.09e-5 SMART
DUF1900 256 390 4.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164980
SMART Domains Protein: ENSMUSP00000129314
Gene: ENSMUSG00000004530

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
Pfam:WD40 120 149 8e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm13723 C A 2: 86,873,262 V154L probably benign Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Nup160 T A 2: 90,702,711 probably null Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Coro1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Coro1c APN 5 113849614 missense probably benign 0.07
IGL01138:Coro1c APN 5 113852161 splice site probably benign
IGL01474:Coro1c APN 5 113882155 splice site probably benign
IGL02075:Coro1c APN 5 113844393 missense probably damaging 1.00
IGL02106:Coro1c APN 5 113852273 missense probably benign 0.01
IGL02831:Coro1c APN 5 113844408 missense probably benign
R0254:Coro1c UTSW 5 113845252 missense probably benign 0.09
R0975:Coro1c UTSW 5 113882121 missense probably damaging 1.00
R1835:Coro1c UTSW 5 113848543 missense probably benign 0.10
R2944:Coro1c UTSW 5 113850800 missense probably damaging 1.00
R5210:Coro1c UTSW 5 113845306 missense probably damaging 1.00
R5354:Coro1c UTSW 5 113846165 missense possibly damaging 0.94
R5379:Coro1c UTSW 5 113845382 missense probably damaging 1.00
R5414:Coro1c UTSW 5 113848546 missense possibly damaging 0.55
R5869:Coro1c UTSW 5 113850846 intron probably benign
R5891:Coro1c UTSW 5 113850811 missense probably damaging 0.98
R7037:Coro1c UTSW 5 113845396 missense possibly damaging 0.60
R7116:Coro1c UTSW 5 113852206 nonsense probably null
R7536:Coro1c UTSW 5 113845289 missense probably damaging 1.00
R7855:Coro1c UTSW 5 113848597 missense probably benign 0.21
R8043:Coro1c UTSW 5 113865759 splice site silent
R8078:Coro1c UTSW 5 113882103 missense probably damaging 0.98
X0018:Coro1c UTSW 5 113848594 missense probably benign 0.13
Z1088:Coro1c UTSW 5 113850649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGCTTTCAGCATGAACG -3'
(R):5'- TTTGCATGCATGAGGTCACC -3'

Sequencing Primer
(F):5'- GCATGAACGTGCTCTTACAC -3'
(R):5'- GAGGTCACCTGTATTTACATGCACG -3'
Posted On2019-12-27