Mutagenetix > Incidental Mutations

Incidental Mutation 'R0688:Zswim4'

61234

Institutional Source

Beutler Lab

Gene Symbol

Zswim4

Ensembl Gene

ENSMUSG00000035671

Gene Name

zinc finger SWIM-type containing 4

Synonyms

E130119J17Rik

MMRRC Submission

038873-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R0688 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

84210678-84237055 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84228888 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 301 (M301V)

Ref Sequence

ENSEMBL: ENSMUSP00000040078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039480]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039480
AA Change: M301V

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671
AA Change: M301V

Domain	Start	End	E-Value	Type
low complexity region	531	545	N/A	INTRINSIC
low complexity region	576	588	N/A	INTRINSIC
low complexity region	607	628	N/A	INTRINSIC
low complexity region	672	683	N/A	INTRINSIC
low complexity region	907	917	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad11	T	G	9: 104,124,100	V615G	probably damaging	Het
Apaf1	T	G	10: 91,061,705	E305D	possibly damaging	Het
Apol10b	A	G	15: 77,585,219	S253P	probably damaging	Het
Bbs9	T	A	9: 22,567,719	C153S	probably damaging	Het
Bicra	C	T	7: 15,989,322	G90D	probably damaging	Het
Clca4a	A	C	3: 144,961,974	L412R	probably damaging	Het
Cul3	A	T	1: 80,271,564	D597E	possibly damaging	Het
Cxcr5	A	G	9: 44,513,667		probably null	Het
Dnah10	T	C	5: 124,747,718	I646T	possibly damaging	Het
Focad	T	A	4: 88,274,213	V593D	unknown	Het
Fsip2	T	A	2: 82,982,339	S3001T	probably benign	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gdf9	T	A	11: 53,436,640	L141Q	probably damaging	Het
Gm13083	T	C	4: 143,617,357	F409S	probably benign	Het
Gm4450	T	C	3: 98,456,394	E45G	probably benign	Het
Gpr180	A	G	14: 118,148,184	D136G	probably benign	Het
Itga2	G	T	13: 114,839,554	A1094E	probably benign	Het
Ly75	C	T	2: 60,316,221	A1238T	probably benign	Het
Macc1	T	C	12: 119,447,003	V502A	probably damaging	Het
Mroh4	T	C	15: 74,606,678	K923E	probably damaging	Het
Msh3	G	A	13: 92,351,431	P93S	possibly damaging	Het
Myo18a	A	G	11: 77,824,140	D474G	probably damaging	Het
Npat	T	A	9: 53,570,222	Y1077N	probably benign	Het
Olfr1214	A	T	2: 88,987,595	S202R	probably damaging	Het
Olfr427	A	C	1: 174,100,064	H202P	probably damaging	Het
Olfr52	A	T	2: 86,181,605		probably null	Het
Olfr816	T	G	10: 129,911,883	T132P	probably damaging	Het
Paqr5	T	G	9: 61,972,794	T59P	probably benign	Het
Phyhipl	C	T	10: 70,559,255	G329R	probably damaging	Het
Pomgnt1	T	C	4: 116,155,889	Y430H	probably damaging	Het
Prkd3	A	T	17: 78,957,233	M651K	probably damaging	Het
Puf60	A	T	15: 76,070,774	M440K	probably damaging	Het
Recql4	A	G	15: 76,709,809		probably null	Het
Sgk1	A	C	10: 21,998,160	M320L	probably benign	Het
Slc27a4	T	C	2: 29,812,615	F509S	probably damaging	Het
Sorbs1	T	C	19: 40,363,262	T235A	probably damaging	Het
Srrm3	A	G	5: 135,869,276		probably benign	Het
Tex15	C	T	8: 33,573,500	T986I	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het

Other mutations in Zswim4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Zswim4	APN	8	84212140	missense	probably damaging	1.00
IGL03048:Zswim4	UTSW	8	84211975	missense	possibly damaging	0.95
R0217:Zswim4	UTSW	8	84212664	missense	probably damaging	1.00
R1217:Zswim4	UTSW	8	84219972	missense	possibly damaging	0.89
R1853:Zswim4	UTSW	8	84224200	missense	probably damaging	1.00
R1878:Zswim4	UTSW	8	84212776	missense	possibly damaging	0.55
R2205:Zswim4	UTSW	8	84225869	missense	possibly damaging	0.70
R2940:Zswim4	UTSW	8	84223748	missense	probably damaging	1.00
R3747:Zswim4	UTSW	8	84212047	missense	possibly damaging	0.86
R3748:Zswim4	UTSW	8	84212047	missense	possibly damaging	0.86
R3750:Zswim4	UTSW	8	84212047	missense	possibly damaging	0.86
R4777:Zswim4	UTSW	8	84236957	missense	probably benign
R4831:Zswim4	UTSW	8	84212319	missense	probably damaging	1.00
R4959:Zswim4	UTSW	8	84212223	missense	probably benign	0.22
R4968:Zswim4	UTSW	8	84217372	missense	probably benign	0.37
R4973:Zswim4	UTSW	8	84212223	missense	probably benign	0.22
R4977:Zswim4	UTSW	8	84226667	splice site	probably null
R4978:Zswim4	UTSW	8	84226667	splice site	probably null
R4980:Zswim4	UTSW	8	84226667	splice site	probably null
R4981:Zswim4	UTSW	8	84226667	splice site	probably null
R4982:Zswim4	UTSW	8	84226667	splice site	probably null
R4983:Zswim4	UTSW	8	84226667	splice site	probably null
R5248:Zswim4	UTSW	8	84219932	missense	probably benign	0.13
R5337:Zswim4	UTSW	8	84235079	missense	probably damaging	1.00
R5366:Zswim4	UTSW	8	84212790	missense	probably benign	0.39
R5646:Zswim4	UTSW	8	84231110	splice site	probably null
R5845:Zswim4	UTSW	8	84217242	splice site	probably null
R6193:Zswim4	UTSW	8	84226145	missense	probably benign
R6270:Zswim4	UTSW	8	84230951	missense	probably damaging	1.00
R6648:Zswim4	UTSW	8	84230914	missense	probably benign	0.22
R6920:Zswim4	UTSW	8	84214085	missense	probably benign	0.01
R7117:Zswim4	UTSW	8	84214052	missense	probably damaging	1.00
R7155:Zswim4	UTSW	8	84219927	missense	probably damaging	1.00
R7344:Zswim4	UTSW	8	84223698	nonsense	probably null
R7354:Zswim4	UTSW	8	84228849	missense	probably damaging	1.00
R8036:Zswim4	UTSW	8	84223289	missense	probably benign	0.22
R8408:Zswim4	UTSW	8	84212385	missense	possibly damaging	0.82
R8518:Zswim4	UTSW	8	84211957	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGGTTTTACGTCAGGTCCC -3'
(R):5'- TCCATGTTCAGCAAGGTGCCAAG -3'

Sequencing Primer
(F):5'- gacttttgtgttttgttctctctg -3'
(R):5'- CAAGGTGCCAAGGCTGG -3'

Posted On

2013-07-30