Incidental Mutation 'R0688:Zswim4'
ID61234
Institutional Source Beutler Lab
Gene Symbol Zswim4
Ensembl Gene ENSMUSG00000035671
Gene Namezinc finger SWIM-type containing 4
SynonymsE130119J17Rik
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0688 (G1)
Quality Score94
Status Not validated
Chromosome8
Chromosomal Location84210678-84237055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84228888 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 301 (M301V)
Ref Sequence ENSEMBL: ENSMUSP00000040078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039480
AA Change: M301V

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671
AA Change: M301V

DomainStartEndE-ValueType
low complexity region 531 545 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Other mutations in Zswim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Zswim4 APN 8 84212140 missense probably damaging 1.00
IGL03048:Zswim4 UTSW 8 84211975 missense possibly damaging 0.95
R0217:Zswim4 UTSW 8 84212664 missense probably damaging 1.00
R1217:Zswim4 UTSW 8 84219972 missense possibly damaging 0.89
R1853:Zswim4 UTSW 8 84224200 missense probably damaging 1.00
R1878:Zswim4 UTSW 8 84212776 missense possibly damaging 0.55
R2205:Zswim4 UTSW 8 84225869 missense possibly damaging 0.70
R2940:Zswim4 UTSW 8 84223748 missense probably damaging 1.00
R3747:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3748:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3750:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R4777:Zswim4 UTSW 8 84236957 missense probably benign
R4831:Zswim4 UTSW 8 84212319 missense probably damaging 1.00
R4959:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4968:Zswim4 UTSW 8 84217372 missense probably benign 0.37
R4973:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4977:Zswim4 UTSW 8 84226667 splice site probably null
R4978:Zswim4 UTSW 8 84226667 splice site probably null
R4980:Zswim4 UTSW 8 84226667 splice site probably null
R4981:Zswim4 UTSW 8 84226667 splice site probably null
R4982:Zswim4 UTSW 8 84226667 splice site probably null
R4983:Zswim4 UTSW 8 84226667 splice site probably null
R5248:Zswim4 UTSW 8 84219932 missense probably benign 0.13
R5337:Zswim4 UTSW 8 84235079 missense probably damaging 1.00
R5366:Zswim4 UTSW 8 84212790 missense probably benign 0.39
R5646:Zswim4 UTSW 8 84231110 splice site probably null
R5845:Zswim4 UTSW 8 84217242 splice site probably null
R6193:Zswim4 UTSW 8 84226145 missense probably benign
R6270:Zswim4 UTSW 8 84230951 missense probably damaging 1.00
R6648:Zswim4 UTSW 8 84230914 missense probably benign 0.22
R6920:Zswim4 UTSW 8 84214085 missense probably benign 0.01
R7117:Zswim4 UTSW 8 84214052 missense probably damaging 1.00
R7155:Zswim4 UTSW 8 84219927 missense probably damaging 1.00
R7344:Zswim4 UTSW 8 84223698 nonsense probably null
R7354:Zswim4 UTSW 8 84228849 missense probably damaging 1.00
R8036:Zswim4 UTSW 8 84223289 missense probably benign 0.22
R8408:Zswim4 UTSW 8 84212385 missense possibly damaging 0.82
R8518:Zswim4 UTSW 8 84211957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGGTTTTACGTCAGGTCCC -3'
(R):5'- TCCATGTTCAGCAAGGTGCCAAG -3'

Sequencing Primer
(F):5'- gacttttgtgttttgttctctctg -3'
(R):5'- CAAGGTGCCAAGGCTGG -3'
Posted On2013-07-30