Incidental Mutation 'R7938:Gm10436'
ID612340
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88176083 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 450 (I450N)
Ref Sequence ENSEMBL: ENSMUSP00000071508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect probably benign
Transcript: ENSMUST00000071580
AA Change: I450N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: I450N

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220521
AA Change: I255N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably benign
Transcript: ENSMUST00000222081
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect probably benign
Transcript: ENSMUST00000222556
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm13723 C A 2: 86,873,262 V154L probably benign Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Nup160 T A 2: 90,702,711 probably null Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1279:Gm10436 UTSW 12 88175880 missense probably benign 0.42
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R2412:Gm10436 UTSW 12 88177110 missense probably damaging 0.98
R3040:Gm10436 UTSW 12 88178348 missense probably benign 0.00
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5601:Gm10436 UTSW 12 88176047 missense probably damaging 1.00
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
R6656:Gm10436 UTSW 12 88175993 missense possibly damaging 0.89
R7307:Gm10436 UTSW 12 88181749 missense probably damaging 1.00
R7332:Gm10436 UTSW 12 88176417 missense possibly damaging 0.72
R7544:Gm10436 UTSW 12 88176080 missense probably benign 0.00
R7569:Gm10436 UTSW 12 88176315 missense probably benign
R7645:Gm10436 UTSW 12 88176258 missense probably damaging 1.00
R7752:Gm10436 UTSW 12 88175999 missense probably damaging 1.00
R7855:Gm10436 UTSW 12 88176083 missense probably benign 0.03
R7860:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R7943:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R8113:Gm10436 UTSW 12 88177080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAAAACGGCAACATTGGG -3'
(R):5'- CCTTGAGAGAGTTGGAGATACCC -3'

Sequencing Primer
(F):5'- GCAACATTGGGTATGCCGATC -3'
(R):5'- GTTGGAGATACCCTGAAAACCCTG -3'
Posted On2019-12-27