Incidental Mutation 'R7938:Itgb8'
ID612341
Institutional Source Beutler Lab
Gene Symbol Itgb8
Ensembl Gene ENSMUSG00000025321
Gene Nameintegrin beta 8
Synonyms4832412O06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location119158022-119238802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119166772 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 667 (R667H)
Ref Sequence ENSEMBL: ENSMUSP00000026360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026360]
Predicted Effect probably benign
Transcript: ENSMUST00000026360
AA Change: R667H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026360
Gene: ENSMUSG00000025321
AA Change: R667H

DomainStartEndE-ValueType
Blast:INB 1 44 9e-8 BLAST
PSI 46 95 6.65e-9 SMART
INB 54 469 4.31e-237 SMART
VWA 146 352 2.15e-1 SMART
Blast:INB 494 532 9e-12 BLAST
EGF 551 583 1.53e1 SMART
transmembrane domain 680 702 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene either die before E11.5 as a result of circulatory abnormalities in the placenta or die within the first for days after birth and display intracerebral hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm13723 C A 2: 86,873,262 V154L probably benign Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Nup160 T A 2: 90,702,711 probably null Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Itgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Itgb8 APN 12 119189826 missense probably damaging 0.99
IGL01859:Itgb8 APN 12 119189945 missense probably damaging 1.00
IGL02555:Itgb8 APN 12 119189881 missense probably damaging 1.00
IGL02665:Itgb8 APN 12 119166865 splice site probably benign
IGL02732:Itgb8 APN 12 119163353 missense probably benign 0.09
R0090:Itgb8 UTSW 12 119202563 missense probably benign 0.00
R0245:Itgb8 UTSW 12 119190555 missense probably damaging 1.00
R0629:Itgb8 UTSW 12 119202481 missense probably benign 0.38
R1158:Itgb8 UTSW 12 119202496 missense probably damaging 1.00
R1355:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1370:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1604:Itgb8 UTSW 12 119202530 missense probably damaging 1.00
R1689:Itgb8 UTSW 12 119170820 missense probably benign 0.38
R1782:Itgb8 UTSW 12 119192118 missense probably damaging 0.99
R1789:Itgb8 UTSW 12 119202455 missense probably benign
R2113:Itgb8 UTSW 12 119190612 missense probably damaging 1.00
R2301:Itgb8 UTSW 12 119202455 missense probably benign
R3696:Itgb8 UTSW 12 119177011 missense probably damaging 0.99
R3797:Itgb8 UTSW 12 119163469 missense possibly damaging 0.92
R3911:Itgb8 UTSW 12 119168005 missense possibly damaging 0.65
R4904:Itgb8 UTSW 12 119170871 missense probably benign 0.00
R5391:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5395:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5444:Itgb8 UTSW 12 119237838 utr 5 prime probably benign
R5461:Itgb8 UTSW 12 119168005 missense probably benign 0.28
R5610:Itgb8 UTSW 12 119170694 missense probably damaging 1.00
R5669:Itgb8 UTSW 12 119190628 missense probably damaging 1.00
R5877:Itgb8 UTSW 12 119202536 missense probably benign 0.37
R6581:Itgb8 UTSW 12 119163215 missense probably benign 0.41
R6597:Itgb8 UTSW 12 119173398 missense possibly damaging 0.94
R6631:Itgb8 UTSW 12 119180977 nonsense probably null
R6971:Itgb8 UTSW 12 119190631 missense probably damaging 1.00
R7124:Itgb8 UTSW 12 119202424 nonsense probably null
R7246:Itgb8 UTSW 12 119168050 missense probably damaging 1.00
R7282:Itgb8 UTSW 12 119237708 missense probably benign 0.00
R7299:Itgb8 UTSW 12 119202461 missense probably benign 0.00
R7340:Itgb8 UTSW 12 119192204 missense probably benign 0.45
R7373:Itgb8 UTSW 12 119202475 missense probably benign 0.01
R7766:Itgb8 UTSW 12 119163359 missense probably damaging 1.00
R7855:Itgb8 UTSW 12 119166772 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCACCTAAGTATTTCTCTTTGGGAG -3'
(R):5'- TTGAGTTGAACTGTGCAAGTACTC -3'

Sequencing Primer
(F):5'- ACAGGGTGTGTTTTTGTTTCTGTTTC -3'
(R):5'- ACTCTGTAGATCAGGCATTCCTAGG -3'
Posted On2019-12-27