Incidental Mutation 'R7938:Gfer'
ID612353
Institutional Source Beutler Lab
Gene Symbol Gfer
Ensembl Gene ENSMUSG00000040888
Gene Namegrowth factor, augmenter of liver regeneration
SynonymsERV1, Alr
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24693191-24696156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24694285 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 198 (D198Y)
Ref Sequence ENSEMBL: ENSMUSP00000049186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007236] [ENSMUST00000019464] [ENSMUST00000046839] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000007236
SMART Domains Protein: ENSMUSP00000007236
Gene: ENSMUSG00000007021

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:MARVEL 20 166 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046839
AA Change: D198Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049186
Gene: ENSMUSG00000040888
AA Change: D198Y

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Pfam:Evr1_Alr 97 189 2.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126319
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E9.5. Mice homozygous for a different knock-out allele are embryonic lethal, while heterozygotes display impaired mitochondrial biogenesis and decreased liver degeneration following partial hepatectomy or acute liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm13723 C A 2: 86,873,262 V154L probably benign Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Nup160 T A 2: 90,702,711 probably null Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Gfer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Gfer APN 17 24695929 missense probably benign 0.01
IGL02898:Gfer APN 17 24695947 missense probably benign
R0242:Gfer UTSW 17 24694303 missense probably damaging 1.00
R0242:Gfer UTSW 17 24694303 missense probably damaging 1.00
R1640:Gfer UTSW 17 24695363 missense possibly damaging 0.95
R4898:Gfer UTSW 17 24695300 missense probably damaging 0.98
R5776:Gfer UTSW 17 24696053 missense probably benign 0.32
R7024:Gfer UTSW 17 24695968 missense probably damaging 1.00
R7203:Gfer UTSW 17 24695862 missense probably damaging 1.00
R7853:Gfer UTSW 17 24694285 missense probably damaging 1.00
R7854:Gfer UTSW 17 24694285 missense probably damaging 1.00
R7855:Gfer UTSW 17 24694285 missense probably damaging 1.00
R7936:Gfer UTSW 17 24694285 missense probably damaging 1.00
X0020:Gfer UTSW 17 24695253 critical splice donor site probably null
Z1177:Gfer UTSW 17 24695887 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGAATCCAGCCTTAAGGAAGC -3'
(R):5'- TGCTTCTCTCAAAGGATAGGCAG -3'

Sequencing Primer
(F):5'- TGAGATTCAGATGACAGCGCCTC -3'
(R):5'- TTCTCTCAAAGGATAGGCAGGAACC -3'
Posted On2019-12-27