Incidental Mutation 'R7939:Ttc34'
ID612367
Institutional Source Beutler Lab
Gene Symbol Ttc34
Ensembl Gene ENSMUSG00000046637
Gene Nametetratricopeptide repeat domain 34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7939 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154837459-154867127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154861286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000051782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050220] [ENSMUST00000207854]
Predicted Effect probably benign
Transcript: ENSMUST00000050220
AA Change: V259A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051782
Gene: ENSMUSG00000046637
AA Change: V259A

DomainStartEndE-ValueType
Blast:TPR 38 68 4e-6 BLAST
low complexity region 69 85 N/A INTRINSIC
TPR 166 199 2.66e0 SMART
TPR 200 233 4.45e-2 SMART
TPR 294 327 9e1 SMART
Blast:TPR 328 361 2e-7 BLAST
TPR 412 445 8.77e1 SMART
TPR 452 485 1.78e-1 SMART
Blast:TPR 500 533 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207854
AA Change: V768A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T C 3: 138,286,912 V263A probably damaging Het
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Fcgr1 A T 3: 96,284,627 probably null Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Krtcap3 T A 5: 31,251,946 M19K probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Reg1 T C 6: 78,427,361 S73P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Ttc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03000:Ttc34 APN 4 154865431 missense probably damaging 1.00
IGL03034:Ttc34 APN 4 154861183 missense probably damaging 1.00
IGL03139:Ttc34 APN 4 154861270 missense probably benign 0.04
R1205:Ttc34 UTSW 4 154862214 missense probably benign 0.01
R1775:Ttc34 UTSW 4 154862214 missense probably benign 0.00
R1935:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1936:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1937:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1939:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1940:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R3701:Ttc34 UTSW 4 154865482 missense probably damaging 1.00
R5181:Ttc34 UTSW 4 154862246 missense probably benign 0.00
R5845:Ttc34 UTSW 4 154865472 missense probably benign 0.08
R6603:Ttc34 UTSW 4 154839305 missense probably benign 0.34
R6930:Ttc34 UTSW 4 154839086 missense probably damaging 0.99
R7209:Ttc34 UTSW 4 154839128 missense probably damaging 1.00
R7548:Ttc34 UTSW 4 154856359 missense probably damaging 1.00
R7640:Ttc34 UTSW 4 154861384 missense probably benign
R7727:Ttc34 UTSW 4 154839274 missense possibly damaging 0.81
R7856:Ttc34 UTSW 4 154861286 missense probably benign
R7893:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7894:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
R7976:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7977:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
Z1177:Ttc34 UTSW 4 154865397 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAGGCCATGGATAGTCGGAG -3'
(R):5'- AATGTGGCACAGAGACCCATG -3'

Sequencing Primer
(F):5'- ACTTTCTGAGTCTCCGGGGAG -3'
(R):5'- AGAGACCCATGTCCCCTG -3'
Posted On2019-12-27