Incidental Mutation 'R0688:Npat'
ID61237
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Namenuclear protein in the AT region
Synonyms
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0688 (G1)
Quality Score174
Status Not validated
Chromosome9
Chromosomal Location53537047-53574342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53570222 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1077 (Y1077N)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
Predicted Effect probably benign
Transcript: ENSMUST00000035850
AA Change: Y1077N

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: Y1077N

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148336
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53566800 missense possibly damaging 0.82
IGL00503:Npat APN 9 53572649 utr 3 prime probably benign
IGL00694:Npat APN 9 53563517 missense probably benign 0.00
IGL00731:Npat APN 9 53562086 missense probably damaging 0.99
IGL00907:Npat APN 9 53563290 missense possibly damaging 0.64
IGL00949:Npat APN 9 53563362 missense probably benign 0.17
IGL01403:Npat APN 9 53555129 missense probably benign 0.02
IGL01626:Npat APN 9 53556571 missense possibly damaging 0.92
IGL01936:Npat APN 9 53558226 splice site probably benign
IGL02142:Npat APN 9 53569907 missense probably benign
IGL02215:Npat APN 9 53559117 missense probably benign 0.00
IGL02250:Npat APN 9 53548951 nonsense probably null
IGL02624:Npat APN 9 53566810 missense probably damaging 1.00
IGL02928:Npat APN 9 53566838 splice site probably benign
IGL02931:Npat APN 9 53571041 nonsense probably null
IGL03128:Npat APN 9 53550033 splice site probably benign
IGL03238:Npat APN 9 53570426 missense probably damaging 0.98
R0606:Npat UTSW 9 53556481 critical splice donor site probably null
R0839:Npat UTSW 9 53545180 missense probably damaging 0.99
R0947:Npat UTSW 9 53570324 missense probably benign 0.08
R1070:Npat UTSW 9 53572592 missense probably damaging 1.00
R1480:Npat UTSW 9 53563066 frame shift probably null
R1599:Npat UTSW 9 53562404 missense possibly damaging 0.62
R1644:Npat UTSW 9 53570172 missense probably damaging 1.00
R1646:Npat UTSW 9 53555134 missense probably benign 0.32
R1699:Npat UTSW 9 53562660 missense probably benign
R1765:Npat UTSW 9 53570222 missense probably benign 0.00
R1793:Npat UTSW 9 53552289 missense probably damaging 1.00
R1866:Npat UTSW 9 53563116 missense probably damaging 1.00
R1898:Npat UTSW 9 53563637 missense probably damaging 1.00
R2018:Npat UTSW 9 53562491 missense probably benign 0.34
R2019:Npat UTSW 9 53562491 missense probably benign 0.34
R2213:Npat UTSW 9 53552381 missense probably benign 0.00
R2432:Npat UTSW 9 53558135 missense probably damaging 1.00
R3816:Npat UTSW 9 53569916 missense probably damaging 0.99
R4764:Npat UTSW 9 53572620 missense probably damaging 1.00
R4889:Npat UTSW 9 53562207 missense probably benign 0.00
R4895:Npat UTSW 9 53570489 missense probably damaging 1.00
R4923:Npat UTSW 9 53571030 missense probably damaging 1.00
R5377:Npat UTSW 9 53550036 critical splice acceptor site probably null
R5397:Npat UTSW 9 53570474 missense probably damaging 1.00
R5504:Npat UTSW 9 53570264 missense probably benign 0.01
R5509:Npat UTSW 9 53570242 missense probably benign 0.00
R5563:Npat UTSW 9 53563127 missense probably damaging 0.97
R5677:Npat UTSW 9 53555100 missense probably benign 0.00
R5868:Npat UTSW 9 53570124 missense probably damaging 0.96
R5927:Npat UTSW 9 53562221 nonsense probably null
R6009:Npat UTSW 9 53563449 missense probably damaging 0.99
R6247:Npat UTSW 9 53545238 missense probably damaging 1.00
R6434:Npat UTSW 9 53563439 missense possibly damaging 0.81
R6784:Npat UTSW 9 53558158 missense probably damaging 1.00
R6799:Npat UTSW 9 53551630 missense probably benign 0.21
R6878:Npat UTSW 9 53556599 missense probably benign
R7027:Npat UTSW 9 53569916 missense possibly damaging 0.90
R7383:Npat UTSW 9 53562778 missense probably benign
R7404:Npat UTSW 9 53554933 intron probably null
R7408:Npat UTSW 9 53569916 missense probably damaging 0.99
R7444:Npat UTSW 9 53548910 missense probably damaging 0.97
R7755:Npat UTSW 9 53559170 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCATGTCATACGCAGAGGTGAGC -3'
(R):5'- TGCCCCAATTAAAGAACTGGCAGG -3'

Sequencing Primer
(F):5'- CAGAGGTGAGCATAAAATATGTTGC -3'
(R):5'- AGACTCAAGGGCCACTTCTG -3'
Posted On2013-07-30