Incidental Mutation 'R0688:Acad11'
ID61239
Institutional Source Beutler Lab
Gene Symbol Acad11
Ensembl Gene ENSMUSG00000090150
Gene Nameacyl-Coenzyme A dehydrogenase family, member 11
Synonyms5730439E10Rik
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0688 (G1)
Quality Score107
Status Not validated
Chromosome9
Chromosomal Location104063377-104127725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104124100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 615 (V615G)
Ref Sequence ENSEMBL: ENSMUSP00000112994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047799] [ENSMUST00000076147] [ENSMUST00000120854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047799
AA Change: V733G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150
AA Change: V733G

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076147
SMART Domains Protein: ENSMUSP00000075507
Gene: ENSMUSG00000079355

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Pfam:7tm_1 58 303 8.9e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120854
AA Change: V615G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150
AA Change: V615G

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216220
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26. Naturally occurring read-through transcription occurs between the upstream gene NPHP3 (nephronophthisis 3 (adolescent)) and this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Acad11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Acad11 APN 9 104126656 missense probably damaging 1.00
IGL01100:Acad11 APN 9 104076408 missense probably damaging 0.98
IGL01920:Acad11 APN 9 104063905 critical splice donor site probably null
IGL02019:Acad11 APN 9 104115345 missense probably damaging 1.00
IGL02506:Acad11 APN 9 104091732 critical splice donor site probably null
IGL02742:Acad11 APN 9 104095625 missense probably damaging 1.00
IGL02830:Acad11 APN 9 104075919 missense probably damaging 1.00
IGL02936:Acad11 APN 9 104113512 missense probably benign 0.31
R0092:Acad11 UTSW 9 104090341 splice site probably benign
R0277:Acad11 UTSW 9 104124025 missense probably damaging 1.00
R0377:Acad11 UTSW 9 104081692 splice site probably benign
R0411:Acad11 UTSW 9 104116296 missense probably damaging 1.00
R0556:Acad11 UTSW 9 104115302 missense probably damaging 1.00
R0594:Acad11 UTSW 9 104095563 missense probably benign 0.09
R1416:Acad11 UTSW 9 104073623 missense probably damaging 0.96
R1551:Acad11 UTSW 9 104126586 missense probably damaging 0.99
R1730:Acad11 UTSW 9 104063882 missense probably benign 0.02
R1819:Acad11 UTSW 9 104114539 critical splice donor site probably null
R1884:Acad11 UTSW 9 104114485 missense probably benign 0.13
R2411:Acad11 UTSW 9 104086023 intron probably benign
R3055:Acad11 UTSW 9 104076336 missense probably damaging 0.98
R3683:Acad11 UTSW 9 104115344 missense probably damaging 1.00
R3954:Acad11 UTSW 9 104086152 intron probably benign
R3956:Acad11 UTSW 9 104086152 intron probably benign
R4425:Acad11 UTSW 9 104073645 missense probably damaging 1.00
R4557:Acad11 UTSW 9 104082839 missense probably benign 0.00
R4701:Acad11 UTSW 9 104095565 nonsense probably null
R4764:Acad11 UTSW 9 104075877 missense probably damaging 0.99
R4872:Acad11 UTSW 9 104086266 intron probably benign
R5132:Acad11 UTSW 9 104126592 missense probably benign 0.03
R5161:Acad11 UTSW 9 104124028 missense probably benign 0.19
R5222:Acad11 UTSW 9 104097377 missense probably damaging 1.00
R5587:Acad11 UTSW 9 104063767 missense probably benign
R5683:Acad11 UTSW 9 104084283 missense probably damaging 1.00
R6512:Acad11 UTSW 9 104095559 nonsense probably null
R6815:Acad11 UTSW 9 104081327 missense probably benign 0.01
R7035:Acad11 UTSW 9 104113495 missense probably damaging 1.00
R7318:Acad11 UTSW 9 104081267 missense probably damaging 1.00
R7564:Acad11 UTSW 9 104123089 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAATACAGCCTTAGCCGAAGCC -3'
(R):5'- GGTGCTACTGTACTCACCTTCACAC -3'

Sequencing Primer
(F):5'- AGCCGAAGCCTTCTGTTG -3'
(R):5'- TCACACCAGTTCTTCAAATGC -3'
Posted On2013-07-30