Incidental Mutation 'R0688:Phyhipl'
ID61243
Institutional Source Beutler Lab
Gene Symbol Phyhipl
Ensembl Gene ENSMUSG00000037747
Gene Namephytanoyl-CoA hydroxylase interacting protein-like
Synonyms
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0688 (G1)
Quality Score130
Status Not validated
Chromosome10
Chromosomal Location70557682-70655965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70559255 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 329 (G329R)
Ref Sequence ENSEMBL: ENSMUSP00000125179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046513] [ENSMUST00000062883] [ENSMUST00000105436] [ENSMUST00000162251] [ENSMUST00000173042]
Predicted Effect probably damaging
Transcript: ENSMUST00000046513
AA Change: G374R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045807
Gene: ENSMUSG00000037747
AA Change: G374R

DomainStartEndE-ValueType
FN3 49 142 6.16e-2 SMART
Blast:FN3 188 262 2e-45 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000062883
SMART Domains Protein: ENSMUSP00000051375
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 529 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105436
SMART Domains Protein: ENSMUSP00000101076
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 118 140 N/A INTRINSIC
low complexity region 192 212 N/A INTRINSIC
coiled coil region 222 290 N/A INTRINSIC
coiled coil region 447 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162144
SMART Domains Protein: ENSMUSP00000124828
Gene: ENSMUSG00000037747

DomainStartEndE-ValueType
FN3 37 130 6.16e-2 SMART
Blast:FN3 176 212 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162251
AA Change: G329R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125179
Gene: ENSMUSG00000037747
AA Change: G329R

DomainStartEndE-ValueType
FN3 4 97 6.16e-2 SMART
Blast:FN3 143 217 9e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162470
Predicted Effect probably benign
Transcript: ENSMUST00000173042
SMART Domains Protein: ENSMUSP00000134648
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 528 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219514
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Phyhipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Phyhipl APN 10 70570830 missense probably damaging 1.00
IGL03374:Phyhipl APN 10 70565279 missense possibly damaging 0.47
PIT4366001:Phyhipl UTSW 10 70568958 missense probably benign
R0512:Phyhipl UTSW 10 70568918 missense probably damaging 0.99
R1136:Phyhipl UTSW 10 70569072 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1802:Phyhipl UTSW 10 70599025 missense probably benign
R1978:Phyhipl UTSW 10 70559761 missense possibly damaging 0.94
R4077:Phyhipl UTSW 10 70569073 missense probably damaging 1.00
R4960:Phyhipl UTSW 10 70568985 missense probably benign 0.40
R4976:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5119:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5739:Phyhipl UTSW 10 70559569 missense possibly damaging 0.92
R6303:Phyhipl UTSW 10 70559557 unclassified probably null
R6304:Phyhipl UTSW 10 70559557 unclassified probably null
R6649:Phyhipl UTSW 10 70569013 missense probably damaging 1.00
X0022:Phyhipl UTSW 10 70568961 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCATCTAGGCAAACAGTGTCAG -3'
(R):5'- AGCAGCGCCTTCCTCAACTAAATTC -3'

Sequencing Primer
(F):5'- AACCTGGGGACATCGTTG -3'
(R):5'- TACAGAAGAAGATGGGGTGCTG -3'
Posted On2013-07-30