Incidental Mutation 'R7940:Dsg1b'
ID612450
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7940 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20396463 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 322 (M322L)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably benign
Transcript: ENSMUST00000076737
AA Change: M322L

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: M322L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,490,484 N307I probably benign Het
Ahnak G A 19: 9,007,468 V2039M probably damaging Het
Arhgef40 T A 14: 51,988,755 H85Q probably damaging Het
Ash1l T A 3: 88,984,309 L1165* probably null Het
Cck A G 9: 121,493,448 W100R probably damaging Het
Cdon A G 9: 35,456,612 R268G possibly damaging Het
Cldn12 T C 5: 5,508,209 T73A probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Cyp2b13 T A 7: 26,088,728 L427Q possibly damaging Het
Dnah3 A T 7: 119,951,704 Y152N probably damaging Het
Efhc1 T C 1: 20,975,002 M414T probably benign Het
Elp3 G A 14: 65,563,310 T302M probably benign Het
Entpd6 T C 2: 150,765,553 probably null Het
Epb41l4a G T 18: 34,006,045 C13* probably null Het
Ephb6 T C 6: 41,613,397 S28P probably benign Het
Fbxo21 T C 5: 117,988,813 S210P probably benign Het
Gapvd1 T A 2: 34,729,067 E98V probably benign Het
Gcdh A G 8: 84,892,464 V157A probably damaging Het
Gm10638 G T 8: 86,746,263 R188L unknown Het
Grk3 T C 5: 112,961,561 T177A unknown Het
Gsc T G 12: 104,472,165 E148A probably damaging Het
Hacd4 C T 4: 88,437,465 G61E probably damaging Het
Herc3 G A 6: 58,843,652 W7* probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il1rl2 T C 1: 40,327,482 Y59H probably benign Het
Kif1c A G 11: 70,728,277 T913A probably benign Het
Lipg C T 18: 74,945,820 G454R probably damaging Het
Lrrc74a A G 12: 86,741,711 D155G probably benign Het
Ltf A T 9: 111,022,376 I137F probably benign Het
Med19 T A 2: 84,685,625 M166K probably damaging Het
Mei1 A T 15: 82,092,717 Y167F not run Het
Mrvi1 T A 7: 110,923,535 K234* probably null Het
Ncaph A C 2: 127,104,245 D724E probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Npffr1 G T 10: 61,613,986 W13L probably benign Het
Olfr65 A T 7: 103,906,610 H54L Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Pcdha7 A T 18: 36,975,839 E639V probably damaging Het
Pcdhb18 A T 18: 37,491,311 M565L probably benign Het
Plcd3 A T 11: 103,077,934 D310E probably benign Het
Pmm2 C G 16: 8,642,768 Q29E probably benign Het
Poli T G 18: 70,509,154 E658D probably benign Het
Polr2f T A 15: 79,151,323 probably null Het
Prss22 G A 17: 23,993,879 R295C probably damaging Het
Psg26 A G 7: 18,478,290 I380T possibly damaging Het
Reep5 A T 18: 34,372,468 V50E possibly damaging Het
Rfx7 A G 9: 72,593,323 T122A possibly damaging Het
Robo1 A G 16: 72,970,211 N424D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Slc4a7 T C 14: 14,772,624 V711A probably benign Het
Smc4 T C 3: 69,033,219 V1162A possibly damaging Het
Snta1 A T 2: 154,383,897 L189H probably benign Het
Tmc3 T A 7: 83,607,440 probably null Het
Tmem121 C T 12: 113,189,076 R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 V271A probably damaging Het
Tmx4 T G 2: 134,639,662 M114L probably benign Het
Trps1 T A 15: 50,661,005 R1176S probably damaging Het
Usp21 A G 1: 171,286,762 L63P probably benign Het
Vmn2r84 T A 10: 130,390,869 M367L probably benign Het
Wbp2nl A G 15: 82,306,072 N67S probably benign Het
Wdr35 T C 12: 9,008,113 probably null Het
Zfp236 G A 18: 82,668,601 Q271* probably null Het
Zfp831 T C 2: 174,705,242 V1406A probably benign Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7990:Dsg1b UTSW 18 20405210 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTACAGGATCTCTCATTTGCTTTGC -3'
(R):5'- ATGCTTTCCCCAAACCTGATG -3'

Sequencing Primer
(F):5'- GGATCTCTCATTTGCTTTGCTGATAC -3'
(R):5'- ACCTGATGTTTGGAAAGAATTGC -3'
Posted On2019-12-27