Incidental Mutation 'R0688:Gdf9'
ID61246
Institutional Source Beutler Lab
Gene Symbol Gdf9
Ensembl Gene ENSMUSG00000018238
Gene Namegrowth differentiation factor 9
SynonymsGdf-9
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R0688 (G1)
Quality Score91
Status Not validated
Chromosome11
Chromosomal Location53431023-53437904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53436640 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 141 (L141Q)
Ref Sequence ENSEMBL: ENSMUSP00000018382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018382]
Predicted Effect probably damaging
Transcript: ENSMUST00000018382
AA Change: L141Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018382
Gene: ENSMUSG00000018238
AA Change: L141Q

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TGFB 340 441 3.16e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156037
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Female mice that are homozygous null for this gene are sterile with impaired folliculogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a block in folliculogenesis. Mutant oocytes exhibit perinuclear organelle aggregation, unusual Golgi complexes, absence of cortical granules, and impaired granulosa cell connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Gdf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Gdf9 APN 11 53436742 missense probably benign 0.02
R1607:Gdf9 UTSW 11 53437511 missense possibly damaging 0.79
R1651:Gdf9 UTSW 11 53433749 missense probably damaging 0.98
R1902:Gdf9 UTSW 11 53436953 missense probably benign 0.26
R2128:Gdf9 UTSW 11 53437507 missense probably damaging 1.00
R5360:Gdf9 UTSW 11 53437207 missense probably benign 0.42
R5391:Gdf9 UTSW 11 53433797 missense probably benign
R5395:Gdf9 UTSW 11 53433797 missense probably benign
R5470:Gdf9 UTSW 11 53436754 missense probably benign 0.11
R5593:Gdf9 UTSW 11 53433731 missense probably damaging 0.99
R5809:Gdf9 UTSW 11 53433554 missense probably benign 0.03
R5829:Gdf9 UTSW 11 53433689 missense probably benign 0.03
R6394:Gdf9 UTSW 11 53436697 missense probably damaging 1.00
R6442:Gdf9 UTSW 11 53433688 missense probably benign 0.00
R6894:Gdf9 UTSW 11 53436819 missense possibly damaging 0.80
R7171:Gdf9 UTSW 11 53437539 missense probably damaging 1.00
R7650:Gdf9 UTSW 11 53437098 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCTCCCAAGAACTGGCTTTCTGG -3'
(R):5'- TGACAGACAGGTGAATGCTCCTCTC -3'

Sequencing Primer
(F):5'- aaaacaagacctccctgcc -3'
(R):5'- GGGAGGTCACATCAATCTCAATC -3'
Posted On2013-07-30