Incidental Mutation 'R7941:Acadl'
ID612461
Institutional Source Beutler Lab
Gene Symbol Acadl
Ensembl Gene ENSMUSG00000026003
Gene Nameacyl-Coenzyme A dehydrogenase, long-chain
SynonymsLCAD, C79855
Accession Numbers

Genbank: NM_007381.3; Ensembl: ENSMUST00000027153, ENSMUST00000139208

Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R7941 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location66830839-66863277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66838324 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 356 (E356G)
Ref Sequence ENSEMBL: ENSMUSP00000027153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027153]
Predicted Effect probably benign
Transcript: ENSMUST00000027153
AA Change: E356G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027153
Gene: ENSMUSG00000026003
AA Change: E356G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 54 165 1.3e-33 PFAM
Pfam:Acyl-CoA_dh_M 169 266 9.2e-29 PFAM
Pfam:Acyl-CoA_dh_1 278 427 5.1e-44 PFAM
Pfam:Acyl-CoA_dh_2 293 416 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C12- and C16-acylCoA. In mice, deficiency of this gene can cause sudden death, cardiomyopathy as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutation of this gene results in reduced litter size, sudden death between 2-14 weeks of age, reduced serum glucose levels, lipid accumulation in the liver and heart, and cardiomyopathy. Heterozygous mutant animals exhibit reduced litter size. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Acadl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Acadl APN 1 66841705 missense probably damaging 0.97
IGL01983:Acadl APN 1 66841624 nonsense probably null
IGL02550:Acadl APN 1 66845166 critical splice donor site probably null
IGL02934:Acadl APN 1 66836975 missense probably benign 0.33
IGL03002:Acadl APN 1 66836969 missense probably benign 0.01
B6584:Acadl UTSW 1 66848473 splice site probably benign
PIT4377001:Acadl UTSW 1 66838405 missense probably damaging 1.00
R0426:Acadl UTSW 1 66841646 missense probably damaging 0.99
R0639:Acadl UTSW 1 66857408 missense probably benign
R1264:Acadl UTSW 1 66857553 missense probably benign 0.00
R1589:Acadl UTSW 1 66853223 missense probably benign 0.04
R2066:Acadl UTSW 1 66841746 splice site probably null
R3735:Acadl UTSW 1 66853289 missense probably benign 0.41
R4646:Acadl UTSW 1 66831443 missense probably benign 0.00
R5690:Acadl UTSW 1 66853286 missense probably damaging 1.00
R6185:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7686:Acadl UTSW 1 66848398 critical splice donor site probably null
R7699:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7700:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7858:Acadl UTSW 1 66838324 missense probably benign 0.11
R8052:Acadl UTSW 1 66853178 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGACATTATAAACAGACCCAATGG -3'
(R):5'- GTATGCCCTTTTATCGGAACCC -3'

Sequencing Primer
(F):5'- TATAAACAGACCCAATGGAACTTTC -3'
(R):5'- ACACACACAGTTTCACTTTCG -3'
Posted On2019-12-27