Incidental Mutation 'R7941:Adamtsl3'
ID612476
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82450163 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 175 (L175P)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably damaging
Transcript: ENSMUST00000173287
AA Change: L175P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: L175P

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173828
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7617:Adamtsl3 UTSW 7 82556846 intron probably null
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCCCATGGCTGGTTAC -3'
(R):5'- CAACACATTCTCTACTGGGGAATAC -3'

Sequencing Primer
(F):5'- TGGTTACCCTGCACATGC -3'
(R):5'- CTCTACTGGGGAATACATTTACACTG -3'
Posted On2019-12-27