Incidental Mutation 'R7942:Usp53'
ID612496
Institutional Source Beutler Lab
Gene Symbol Usp53
Ensembl Gene ENSMUSG00000039701
Gene Nameubiquitin specific peptidase 53
SynonymsPhxr3, Sp6
Accession Numbers

Ncbi RefSeq: NM_133857.3; MGI: 2139607

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7942 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location122931493-122984510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122949766 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 507 (H507R)
Ref Sequence ENSEMBL: ENSMUSP00000087857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090379] [ENSMUST00000197934] [ENSMUST00000199329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090379
AA Change: H507R

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087857
Gene: ENSMUSG00000039701
AA Change: H507R

DomainStartEndE-ValueType
Pfam:UCH 29 348 1.6e-20 PFAM
Pfam:UCH_1 30 322 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197934
SMART Domains Protein: ENSMUSP00000143412
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
Pfam:UCH 29 375 2.2e-21 PFAM
Pfam:UCH_1 30 349 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199329
SMART Domains Protein: ENSMUSP00000143119
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
Pfam:UCH 29 126 1.8e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss associated with altered cochlear outer hair cell (OHC) morphology, reduced endocochlear potential, and early OHC loss followed by IHC and spiral ganglion degeneration. Heterozygotes are susceptible to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(48) : Gene trapped(48)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dnah2 T C 11: 69,476,596 probably null Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Nup98 A T 7: 102,152,461 probably null Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Other mutations in Usp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Usp53 APN 3 122957718 missense probably damaging 0.99
IGL01965:Usp53 APN 3 122961153 critical splice donor site probably null
IGL02115:Usp53 APN 3 122947390 missense probably benign 0.25
IGL02993:Usp53 APN 3 122933843 missense probably damaging 1.00
IGL03119:Usp53 APN 3 122961415 missense possibly damaging 0.80
IGL03206:Usp53 APN 3 122953183 missense probably benign
IGL03369:Usp53 APN 3 122933721 utr 3 prime probably benign
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0366:Usp53 UTSW 3 122949201 missense probably damaging 1.00
R1015:Usp53 UTSW 3 122933759 missense probably benign 0.02
R1388:Usp53 UTSW 3 122957628 missense probably damaging 0.96
R1592:Usp53 UTSW 3 122934050 nonsense probably null
R1635:Usp53 UTSW 3 122934223 missense probably benign 0.03
R1707:Usp53 UTSW 3 122947400 missense probably benign
R2177:Usp53 UTSW 3 122936057 missense probably damaging 0.99
R2848:Usp53 UTSW 3 122934491 missense probably benign 0.00
R2898:Usp53 UTSW 3 122957574 nonsense probably null
R3411:Usp53 UTSW 3 122949858 critical splice acceptor site probably null
R3618:Usp53 UTSW 3 122934412 missense probably benign 0.25
R3713:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3715:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3923:Usp53 UTSW 3 122934305 missense probably benign 0.11
R4616:Usp53 UTSW 3 122959120 missense probably damaging 1.00
R4718:Usp53 UTSW 3 122933982 missense probably benign 0.22
R4730:Usp53 UTSW 3 122962933 missense probably null 0.82
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R5073:Usp53 UTSW 3 122933946 missense probably benign 0.21
R5580:Usp53 UTSW 3 122934234 missense probably benign 0.00
R5894:Usp53 UTSW 3 122959085 missense probably damaging 0.96
R6176:Usp53 UTSW 3 122934003 nonsense probably null
R6191:Usp53 UTSW 3 122949741 missense probably damaging 0.96
R6634:Usp53 UTSW 3 122964286 missense probably benign 0.00
R7179:Usp53 UTSW 3 122949710 missense probably benign 0.01
R7211:Usp53 UTSW 3 122957650 missense probably damaging 0.98
R7613:Usp53 UTSW 3 122949818 missense probably benign 0.43
R7621:Usp53 UTSW 3 122961285 missense probably benign 0.00
R7652:Usp53 UTSW 3 122953235 missense possibly damaging 0.80
R7753:Usp53 UTSW 3 122949238 missense probably damaging 1.00
R7859:Usp53 UTSW 3 122949766 missense possibly damaging 0.91
R7861:Usp53 UTSW 3 122934463 missense probably benign 0.26
R7911:Usp53 UTSW 3 122961267 missense probably benign 0.00
R7944:Usp53 UTSW 3 122934463 missense probably benign 0.26
R7992:Usp53 UTSW 3 122961267 missense probably benign 0.00
X0025:Usp53 UTSW 3 122957583 critical splice donor site probably null
Z1177:Usp53 UTSW 3 122953195 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGAATCTTGGCTGCTGTC -3'
(R):5'- TGACAGTGTGCCTCATTCTTG -3'

Sequencing Primer
(F):5'- GGCTGCTGTCTGTTTCATATCCAG -3'
(R):5'- AGGCTGGCTTCAAACTCATG -3'
Posted On2019-12-27