Incidental Mutation 'R0688:Gpr180'
ID61252
Institutional Source Beutler Lab
Gene Symbol Gpr180
Ensembl Gene ENSMUSG00000022131
Gene NameG protein-coupled receptor 180
SynonymsITR, E130016I23Rik
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R0688 (G1)
Quality Score127
Status Not validated
Chromosome14
Chromosomal Location118137158-118163261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118148184 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 136 (D136G)
Ref Sequence ENSEMBL: ENSMUSP00000022728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022728]
Predicted Effect probably benign
Transcript: ENSMUST00000022728
AA Change: D136G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022728
Gene: ENSMUSG00000022131
AA Change: D136G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lung_7-TM_R 132 418 2.1e-12 PFAM
Pfam:GpcrRhopsn4 142 406 6.1e-88 PFAM
low complexity region 419 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the G protein-coupled receptor superfamily. This protein is produced predominantly in vascular smooth muscle cells and may play an important role in the regulation of vascular remodeling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are resistant to cuff-induced intimal thickening of the femoral artery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Gpr180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Gpr180 APN 14 118160176 missense probably damaging 1.00
IGL02449:Gpr180 APN 14 118160120 missense probably damaging 1.00
IGL02740:Gpr180 APN 14 118139749 missense probably damaging 1.00
IGL03103:Gpr180 APN 14 118139763 missense possibly damaging 0.95
R0321:Gpr180 UTSW 14 118148287 critical splice donor site probably null
R0545:Gpr180 UTSW 14 118160046 missense possibly damaging 0.77
R0844:Gpr180 UTSW 14 118157947 missense probably damaging 1.00
R2566:Gpr180 UTSW 14 118139773 missense probably benign 0.06
R5334:Gpr180 UTSW 14 118160056 missense probably damaging 0.99
R5378:Gpr180 UTSW 14 118139839 missense probably benign
R5583:Gpr180 UTSW 14 118162698 missense probably damaging 1.00
R6081:Gpr180 UTSW 14 118153674 missense probably benign 0.02
R6851:Gpr180 UTSW 14 118153625 missense probably damaging 1.00
R7382:Gpr180 UTSW 14 118162623 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AAGAGCAAGGTTTTAGCCCCTGTG -3'
(R):5'- CGGTACTTCAGTAAGGCAAGGCAC -3'

Sequencing Primer
(F):5'- TTACGTGAGTGTAGCCTGAGAG -3'
(R):5'- CTAAAGCTCTAAGGAGGCTTTGC -3'
Posted On2013-07-30