Incidental Mutation 'R0688:Mroh4'
ID61253
Institutional Source Beutler Lab
Gene Symbol Mroh4
Ensembl Gene ENSMUSG00000022603
Gene Namemaestro heat-like repeat family member 4
Synonyms1700016M24Rik
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0688 (G1)
Quality Score130
Status Not validated
Chromosome15
Chromosomal Location74606029-74636353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74606678 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 923 (K923E)
Ref Sequence ENSEMBL: ENSMUSP00000023271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023271] [ENSMUST00000137963]
Predicted Effect probably damaging
Transcript: ENSMUST00000023271
AA Change: K923E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023271
Gene: ENSMUSG00000022603
AA Change: K923E

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 520 534 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
SCOP:d1ee4a_ 709 852 3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137963
AA Change: K854E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117011
Gene: ENSMUSG00000022603
AA Change: K854E

DomainStartEndE-ValueType
low complexity region 257 268 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
SCOP:d1ee4a_ 640 783 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177179
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Mroh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mroh4 APN 15 74611358 splice site probably benign
IGL02370:Mroh4 APN 15 74625541 missense probably benign 0.00
IGL02598:Mroh4 APN 15 74611243 critical splice donor site probably null
IGL02644:Mroh4 APN 15 74610375 missense possibly damaging 0.90
IGL02666:Mroh4 APN 15 74609775 missense probably benign 0.04
IGL02723:Mroh4 APN 15 74608237 splice site probably benign
IGL02724:Mroh4 APN 15 74606151 missense probably benign 0.00
IGL03000:Mroh4 APN 15 74616114 missense probably benign
IGL03103:Mroh4 APN 15 74616159 missense possibly damaging 0.47
IGL03194:Mroh4 APN 15 74611539 missense probably damaging 1.00
R0013:Mroh4 UTSW 15 74608237 splice site probably benign
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0294:Mroh4 UTSW 15 74606149 missense probably benign
R0346:Mroh4 UTSW 15 74614292 splice site probably benign
R0545:Mroh4 UTSW 15 74625427 missense probably benign 0.00
R1838:Mroh4 UTSW 15 74616113 missense probably benign 0.03
R2037:Mroh4 UTSW 15 74609761 missense possibly damaging 0.91
R4725:Mroh4 UTSW 15 74616107 missense probably damaging 0.99
R4786:Mroh4 UTSW 15 74610234 missense probably benign 0.08
R4798:Mroh4 UTSW 15 74626179 missense probably damaging 1.00
R4945:Mroh4 UTSW 15 74612008 missense probably benign 0.00
R5065:Mroh4 UTSW 15 74628270 splice site probably null
R5476:Mroh4 UTSW 15 74611661 missense probably benign 0.15
R5509:Mroh4 UTSW 15 74606154 missense probably benign 0.00
R5527:Mroh4 UTSW 15 74615016 missense probably damaging 1.00
R5662:Mroh4 UTSW 15 74625428 missense possibly damaging 0.63
R5818:Mroh4 UTSW 15 74611982 missense probably damaging 0.98
R5861:Mroh4 UTSW 15 74606607 intron probably benign
R5886:Mroh4 UTSW 15 74606447 missense possibly damaging 0.90
R5935:Mroh4 UTSW 15 74621154 missense probably damaging 1.00
R6008:Mroh4 UTSW 15 74625472 nonsense probably null
R6658:Mroh4 UTSW 15 74621129 missense possibly damaging 0.83
R6689:Mroh4 UTSW 15 74612003 missense probably damaging 1.00
R6739:Mroh4 UTSW 15 74609719 missense probably benign 0.10
R6888:Mroh4 UTSW 15 74613249 missense possibly damaging 0.93
R7088:Mroh4 UTSW 15 74626144 missense probably benign 0.25
R7260:Mroh4 UTSW 15 74608129 missense possibly damaging 0.83
R7365:Mroh4 UTSW 15 74610371 nonsense probably null
R7735:Mroh4 UTSW 15 74625508 missense probably damaging 0.98
R7763:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
R7945:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
R8090:Mroh4 UTSW 15 74624701 missense probably benign 0.41
R8242:Mroh4 UTSW 15 74616308 missense possibly damaging 0.47
Z1177:Mroh4 UTSW 15 74627720 missense probably damaging 1.00
Z1177:Mroh4 UTSW 15 74628002 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGATGTCAAGGATGTGGTTAGCAGC -3'
(R):5'- TGGACTCCCCTCACTGGATTGAATG -3'

Sequencing Primer
(F):5'- AGCTGCAACCCTTGTCCAC -3'
(R):5'- TCTAGGGGACTCAGATGCC -3'
Posted On2013-07-30