Incidental Mutation 'R7943:Serpinb3b'
ID612541
Institutional Source Beutler Lab
Gene Symbol Serpinb3b
Ensembl Gene ENSMUSG00000073602
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B
SynonymsScca2-rs
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7943 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location107153940-107278361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107157737 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 91 (K91N)
Ref Sequence ENSEMBL: ENSMUSP00000083901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086694] [ENSMUST00000166100]
Predicted Effect probably damaging
Transcript: ENSMUST00000086694
AA Change: K91N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083901
Gene: ENSMUSG00000073602
AA Change: K91N

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166100
AA Change: K91N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602
AA Change: K91N

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,928,726 T493A probably damaging Het
Aars A G 8: 111,049,861 K650E probably benign Het
Abcb1b C T 5: 8,832,258 S793F probably benign Het
Adamts18 T A 8: 113,775,276 I318F probably damaging Het
Adcy8 A G 15: 64,699,473 I1137T probably damaging Het
Ambra1 T A 2: 91,773,493 F607L probably benign Het
Ankrd46 A T 15: 36,479,420 V175D possibly damaging Het
Arhgap28 C A 17: 67,901,282 E114* probably null Het
Arrdc1 C T 2: 24,926,146 G282S probably damaging Het
Atp1a3 A T 7: 24,981,791 L790Q probably damaging Het
Bend5 T A 4: 111,415,209 V12D probably damaging Het
Bod1l C T 5: 41,819,265 E1569K probably damaging Het
Cdc123 T A 2: 5,803,964 I234L probably benign Het
Cep126 T G 9: 8,120,748 E91D probably damaging Het
Cep89 T A 7: 35,414,145 D199E possibly damaging Het
Ces1d T C 8: 93,171,137 T442A probably benign Het
Chsy3 C T 18: 59,409,227 A479V probably benign Het
Clcn4 C A 7: 7,293,061 G261C probably damaging Het
Clhc1 A T 11: 29,557,651 probably null Het
Cnot3 T A 7: 3,655,566 probably null Het
Col9a1 C A 1: 24,237,180 P723H probably damaging Het
Crybg3 A T 16: 59,555,242 M169K probably benign Het
Cxxc4 A G 3: 134,258,053 R353G probably benign Het
Dennd3 A T 15: 73,540,808 I440F probably damaging Het
Elmo3 G T 8: 105,309,017 S553I probably damaging Het
Elovl2 A G 13: 41,187,467 Y198H probably benign Het
Epm2aip1 A G 9: 111,272,037 Y26C probably damaging Het
Ext1 A C 15: 53,089,939 C510G possibly damaging Het
Extl3 A T 14: 65,077,489 D81E probably benign Het
Fbxl5 T A 5: 43,758,676 T465S probably benign Het
Gabrr2 A T 4: 33,081,470 K169* probably null Het
Gm10436 A T 12: 88,176,352 N360K possibly damaging Het
Haus4 A G 14: 54,542,145 Y341H probably damaging Het
Itgae A T 11: 73,120,273 probably null Het
Jmjd7 C T 2: 120,030,515 H149Y possibly damaging Het
Kcnh2 C T 5: 24,324,563 C725Y probably damaging Het
Mroh1 C T 15: 76,447,332 P1252L probably benign Het
Ms4a14 A G 19: 11,302,944 F750S probably benign Het
Naf1 T A 8: 66,860,513 D49E unknown Het
Notch3 T C 17: 32,122,773 T2002A possibly damaging Het
Olfr1413 G A 1: 92,574,088 D306N probably benign Het
Olfr1495 T A 19: 13,768,352 D3E probably benign Het
Olfr168 A T 16: 19,530,417 C168S probably damaging Het
Olfr301 A G 7: 86,407,911 probably benign Het
Olfr393 A T 11: 73,847,507 I206N probably benign Het
Olfr709-ps1 A T 7: 106,926,570 D296E probably benign Het
Olfr869 A T 9: 20,137,575 N153I probably benign Het
Pck1 A G 2: 173,155,950 T271A possibly damaging Het
Penk A G 4: 4,133,976 W224R possibly damaging Het
Per2 C A 1: 91,444,759 V198F probably damaging Het
Phf11d A G 14: 59,361,831 M23T probably damaging Het
Pla2g4d A G 2: 120,266,730 V796A probably benign Het
Prdx6 A T 1: 161,241,858 probably null Het
Prep A T 10: 45,091,012 N47I probably damaging Het
Prss38 G T 11: 59,375,170 H96N probably damaging Het
Rab11a C A 9: 64,728,331 E47* probably null Het
Rad18 C T 6: 112,649,837 G369D probably benign Het
Rragc T C 4: 123,929,924 V330A probably damaging Het
Serpina9 A T 12: 104,001,421 H238Q probably benign Het
Slc16a12 T G 19: 34,675,330 S139R probably benign Het
Slc22a27 T A 19: 7,910,107 probably null Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Slc38a9 A T 13: 112,731,614 I545F probably benign Het
Slc39a8 A T 3: 135,884,396 H349L probably damaging Het
Slk C T 19: 47,642,071 T1227I possibly damaging Het
Spdye4b A G 5: 143,194,854 E25G possibly damaging Het
St3gal1 A G 15: 67,111,265 V214A probably benign Het
St7l T A 3: 104,926,577 M550K probably benign Het
Tbk1 A C 10: 121,552,246 F638C possibly damaging Het
Tex101 A T 7: 24,669,765 C114S probably damaging Het
Ttll13 A G 7: 80,255,387 M384V probably benign Het
Ugt2b37 A T 5: 87,254,330 D147E probably damaging Het
Vmn1r10 A T 6: 57,113,701 T93S probably benign Het
Wasl G A 6: 24,619,397 P375S unknown Het
Wdr63 A G 3: 146,066,920 L457P probably damaging Het
Zfp236 C A 18: 82,674,356 E165* probably null Het
Zfp839 A T 12: 110,855,626 R291S probably damaging Het
Other mutations in Serpinb3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Serpinb3b APN 1 107157681 missense probably benign 0.20
IGL00543:Serpinb3b APN 1 107157666 critical splice donor site probably null
IGL00846:Serpinb3b APN 1 107155849 missense probably damaging 1.00
IGL00851:Serpinb3b APN 1 107159705 missense probably damaging 1.00
IGL01017:Serpinb3b APN 1 107154457 missense probably benign 0.31
IGL01083:Serpinb3b APN 1 107157743 missense possibly damaging 0.57
IGL01300:Serpinb3b APN 1 107155843 critical splice donor site probably benign
IGL01306:Serpinb3b APN 1 107154665 missense probably damaging 1.00
IGL01604:Serpinb3b APN 1 107154724 missense probably benign 0.00
IGL01936:Serpinb3b APN 1 107154638 missense probably benign 0.13
IGL02125:Serpinb3b APN 1 107154744 missense probably damaging 1.00
IGL03185:Serpinb3b APN 1 107156932 missense probably benign 0.01
ANU23:Serpinb3b UTSW 1 107154665 missense probably damaging 1.00
R0329:Serpinb3b UTSW 1 107159703 missense probably damaging 1.00
R0330:Serpinb3b UTSW 1 107159703 missense probably damaging 1.00
R1465:Serpinb3b UTSW 1 107155843 critical splice donor site probably null
R1465:Serpinb3b UTSW 1 107155843 critical splice donor site probably null
R1635:Serpinb3b UTSW 1 107154673 missense probably benign 0.16
R1713:Serpinb3b UTSW 1 107155434 missense probably benign 0.00
R1898:Serpinb3b UTSW 1 107154587 missense possibly damaging 0.85
R2252:Serpinb3b UTSW 1 107155478 missense possibly damaging 0.71
R3430:Serpinb3b UTSW 1 107154695 missense probably benign 0.21
R4382:Serpinb3b UTSW 1 107155543 missense probably damaging 0.97
R4741:Serpinb3b UTSW 1 107154470 missense probably benign 0.01
R4855:Serpinb3b UTSW 1 107154540 missense possibly damaging 0.59
R4974:Serpinb3b UTSW 1 107154715 missense probably benign 0.01
R4982:Serpinb3b UTSW 1 107157754 missense probably benign 0.03
R5519:Serpinb3b UTSW 1 107159776 start codon destroyed probably null 1.00
R6846:Serpinb3b UTSW 1 107154673 missense probably benign 0.16
R7815:Serpinb3b UTSW 1 107156895 missense probably damaging 1.00
R7860:Serpinb3b UTSW 1 107157737 missense probably damaging 1.00
Z1088:Serpinb3b UTSW 1 107157751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTATGTGAATCTGCCTGG -3'
(R):5'- GGGCATATGCTATCTTATAGGCAG -3'

Sequencing Primer
(F):5'- CCTATGTGAATCTGCCTGGTATCATG -3'
(R):5'- ACACACACGTATATATCAGGGATG -3'
Posted On2019-12-27