Incidental Mutation 'R7943:Bod1l'
ID612559
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7943 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41819265 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1569 (E1569K)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably damaging
Transcript: ENSMUST00000050556
AA Change: E1569K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: E1569K

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202908
AA Change: E1569K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: E1569K

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,928,726 T493A probably damaging Het
Aars A G 8: 111,049,861 K650E probably benign Het
Abcb1b C T 5: 8,832,258 S793F probably benign Het
Adamts18 T A 8: 113,775,276 I318F probably damaging Het
Adcy8 A G 15: 64,699,473 I1137T probably damaging Het
Ambra1 T A 2: 91,773,493 F607L probably benign Het
Ankrd46 A T 15: 36,479,420 V175D possibly damaging Het
Arhgap28 C A 17: 67,901,282 E114* probably null Het
Arrdc1 C T 2: 24,926,146 G282S probably damaging Het
Atp1a3 A T 7: 24,981,791 L790Q probably damaging Het
Bend5 T A 4: 111,415,209 V12D probably damaging Het
Cdc123 T A 2: 5,803,964 I234L probably benign Het
Cep126 T G 9: 8,120,748 E91D probably damaging Het
Cep89 T A 7: 35,414,145 D199E possibly damaging Het
Ces1d T C 8: 93,171,137 T442A probably benign Het
Chsy3 C T 18: 59,409,227 A479V probably benign Het
Clcn4 C A 7: 7,293,061 G261C probably damaging Het
Clhc1 A T 11: 29,557,651 probably null Het
Cnot3 T A 7: 3,655,566 probably null Het
Col9a1 C A 1: 24,237,180 P723H probably damaging Het
Crybg3 A T 16: 59,555,242 M169K probably benign Het
Cxxc4 A G 3: 134,258,053 R353G probably benign Het
Dennd3 A T 15: 73,540,808 I440F probably damaging Het
Elmo3 G T 8: 105,309,017 S553I probably damaging Het
Elovl2 A G 13: 41,187,467 Y198H probably benign Het
Epm2aip1 A G 9: 111,272,037 Y26C probably damaging Het
Ext1 A C 15: 53,089,939 C510G possibly damaging Het
Extl3 A T 14: 65,077,489 D81E probably benign Het
Fbxl5 T A 5: 43,758,676 T465S probably benign Het
Gabrr2 A T 4: 33,081,470 K169* probably null Het
Gm10436 A T 12: 88,176,352 N360K possibly damaging Het
Haus4 A G 14: 54,542,145 Y341H probably damaging Het
Itgae A T 11: 73,120,273 probably null Het
Jmjd7 C T 2: 120,030,515 H149Y possibly damaging Het
Kcnh2 C T 5: 24,324,563 C725Y probably damaging Het
Mroh1 C T 15: 76,447,332 P1252L probably benign Het
Ms4a14 A G 19: 11,302,944 F750S probably benign Het
Naf1 T A 8: 66,860,513 D49E unknown Het
Notch3 T C 17: 32,122,773 T2002A possibly damaging Het
Olfr1413 G A 1: 92,574,088 D306N probably benign Het
Olfr1495 T A 19: 13,768,352 D3E probably benign Het
Olfr168 A T 16: 19,530,417 C168S probably damaging Het
Olfr301 A G 7: 86,407,911 probably benign Het
Olfr393 A T 11: 73,847,507 I206N probably benign Het
Olfr709-ps1 A T 7: 106,926,570 D296E probably benign Het
Olfr869 A T 9: 20,137,575 N153I probably benign Het
Pck1 A G 2: 173,155,950 T271A possibly damaging Het
Penk A G 4: 4,133,976 W224R possibly damaging Het
Per2 C A 1: 91,444,759 V198F probably damaging Het
Phf11d A G 14: 59,361,831 M23T probably damaging Het
Pla2g4d A G 2: 120,266,730 V796A probably benign Het
Prdx6 A T 1: 161,241,858 probably null Het
Prep A T 10: 45,091,012 N47I probably damaging Het
Prss38 G T 11: 59,375,170 H96N probably damaging Het
Rab11a C A 9: 64,728,331 E47* probably null Het
Rad18 C T 6: 112,649,837 G369D probably benign Het
Rragc T C 4: 123,929,924 V330A probably damaging Het
Serpina9 A T 12: 104,001,421 H238Q probably benign Het
Serpinb3b T A 1: 107,157,737 K91N probably damaging Het
Slc16a12 T G 19: 34,675,330 S139R probably benign Het
Slc22a27 T A 19: 7,910,107 probably null Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Slc38a9 A T 13: 112,731,614 I545F probably benign Het
Slc39a8 A T 3: 135,884,396 H349L probably damaging Het
Slk C T 19: 47,642,071 T1227I possibly damaging Het
Spdye4b A G 5: 143,194,854 E25G possibly damaging Het
St3gal1 A G 15: 67,111,265 V214A probably benign Het
St7l T A 3: 104,926,577 M550K probably benign Het
Tbk1 A C 10: 121,552,246 F638C possibly damaging Het
Tex101 A T 7: 24,669,765 C114S probably damaging Het
Ttll13 A G 7: 80,255,387 M384V probably benign Het
Ugt2b37 A T 5: 87,254,330 D147E probably damaging Het
Vmn1r10 A T 6: 57,113,701 T93S probably benign Het
Wasl G A 6: 24,619,397 P375S unknown Het
Wdr63 A G 3: 146,066,920 L457P probably damaging Het
Zfp236 C A 18: 82,674,356 E165* probably null Het
Zfp839 A T 12: 110,855,626 R291S probably damaging Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
R7860:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R8104:Bod1l UTSW 5 41833732 nonsense probably null
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGCACTGGTTACTGCATCG -3'
(R):5'- ACGGACAAAGGCATCATGTTAAAC -3'

Sequencing Primer
(F):5'- ACTGGTTACTGCATCGTCTTTTTC -3'
(R):5'- GGCATCATGTTAAACACAGTCAAG -3'
Posted On2019-12-27