Incidental Mutation 'R7943:Ces1d'
ID612576
Institutional Source Beutler Lab
Gene Symbol Ces1d
Ensembl Gene ENSMUSG00000056973
Gene Namecarboxylesterase 1D
SynonymsTGH, Ces3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7943 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location93166068-93197838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93171137 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 442 (T442A)
Ref Sequence ENSEMBL: ENSMUSP00000034172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034172]
Predicted Effect probably benign
Transcript: ENSMUST00000034172
AA Change: T442A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034172
Gene: ENSMUSG00000056973
AA Change: T442A

DomainStartEndE-ValueType
Pfam:COesterase 1 545 4.9e-169 PFAM
Pfam:Abhydrolase_3 136 256 8.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased blood lipids, improved glucose tolerance, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,928,726 T493A probably damaging Het
Aars A G 8: 111,049,861 K650E probably benign Het
Abcb1b C T 5: 8,832,258 S793F probably benign Het
Adamts18 T A 8: 113,775,276 I318F probably damaging Het
Adcy8 A G 15: 64,699,473 I1137T probably damaging Het
Ambra1 T A 2: 91,773,493 F607L probably benign Het
Ankrd46 A T 15: 36,479,420 V175D possibly damaging Het
Arhgap28 C A 17: 67,901,282 E114* probably null Het
Arrdc1 C T 2: 24,926,146 G282S probably damaging Het
Atp1a3 A T 7: 24,981,791 L790Q probably damaging Het
Bend5 T A 4: 111,415,209 V12D probably damaging Het
Bod1l C T 5: 41,819,265 E1569K probably damaging Het
Cdc123 T A 2: 5,803,964 I234L probably benign Het
Cep126 T G 9: 8,120,748 E91D probably damaging Het
Cep89 T A 7: 35,414,145 D199E possibly damaging Het
Chsy3 C T 18: 59,409,227 A479V probably benign Het
Clcn4 C A 7: 7,293,061 G261C probably damaging Het
Clhc1 A T 11: 29,557,651 probably null Het
Cnot3 T A 7: 3,655,566 probably null Het
Col9a1 C A 1: 24,237,180 P723H probably damaging Het
Crybg3 A T 16: 59,555,242 M169K probably benign Het
Cxxc4 A G 3: 134,258,053 R353G probably benign Het
Dennd3 A T 15: 73,540,808 I440F probably damaging Het
Elmo3 G T 8: 105,309,017 S553I probably damaging Het
Elovl2 A G 13: 41,187,467 Y198H probably benign Het
Epm2aip1 A G 9: 111,272,037 Y26C probably damaging Het
Ext1 A C 15: 53,089,939 C510G possibly damaging Het
Extl3 A T 14: 65,077,489 D81E probably benign Het
Fbxl5 T A 5: 43,758,676 T465S probably benign Het
Gabrr2 A T 4: 33,081,470 K169* probably null Het
Gm10436 A T 12: 88,176,352 N360K possibly damaging Het
Haus4 A G 14: 54,542,145 Y341H probably damaging Het
Itgae A T 11: 73,120,273 probably null Het
Jmjd7 C T 2: 120,030,515 H149Y possibly damaging Het
Kcnh2 C T 5: 24,324,563 C725Y probably damaging Het
Mroh1 C T 15: 76,447,332 P1252L probably benign Het
Ms4a14 A G 19: 11,302,944 F750S probably benign Het
Naf1 T A 8: 66,860,513 D49E unknown Het
Notch3 T C 17: 32,122,773 T2002A possibly damaging Het
Olfr1413 G A 1: 92,574,088 D306N probably benign Het
Olfr1495 T A 19: 13,768,352 D3E probably benign Het
Olfr168 A T 16: 19,530,417 C168S probably damaging Het
Olfr301 A G 7: 86,407,911 probably benign Het
Olfr393 A T 11: 73,847,507 I206N probably benign Het
Olfr709-ps1 A T 7: 106,926,570 D296E probably benign Het
Olfr869 A T 9: 20,137,575 N153I probably benign Het
Pck1 A G 2: 173,155,950 T271A possibly damaging Het
Penk A G 4: 4,133,976 W224R possibly damaging Het
Per2 C A 1: 91,444,759 V198F probably damaging Het
Phf11d A G 14: 59,361,831 M23T probably damaging Het
Pla2g4d A G 2: 120,266,730 V796A probably benign Het
Prdx6 A T 1: 161,241,858 probably null Het
Prep A T 10: 45,091,012 N47I probably damaging Het
Prss38 G T 11: 59,375,170 H96N probably damaging Het
Rab11a C A 9: 64,728,331 E47* probably null Het
Rad18 C T 6: 112,649,837 G369D probably benign Het
Rragc T C 4: 123,929,924 V330A probably damaging Het
Serpina9 A T 12: 104,001,421 H238Q probably benign Het
Serpinb3b T A 1: 107,157,737 K91N probably damaging Het
Slc16a12 T G 19: 34,675,330 S139R probably benign Het
Slc22a27 T A 19: 7,910,107 probably null Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Slc38a9 A T 13: 112,731,614 I545F probably benign Het
Slc39a8 A T 3: 135,884,396 H349L probably damaging Het
Slk C T 19: 47,642,071 T1227I possibly damaging Het
Spdye4b A G 5: 143,194,854 E25G possibly damaging Het
St3gal1 A G 15: 67,111,265 V214A probably benign Het
St7l T A 3: 104,926,577 M550K probably benign Het
Tbk1 A C 10: 121,552,246 F638C possibly damaging Het
Tex101 A T 7: 24,669,765 C114S probably damaging Het
Ttll13 A G 7: 80,255,387 M384V probably benign Het
Ugt2b37 A T 5: 87,254,330 D147E probably damaging Het
Vmn1r10 A T 6: 57,113,701 T93S probably benign Het
Wasl G A 6: 24,619,397 P375S unknown Het
Wdr63 A G 3: 146,066,920 L457P probably damaging Het
Zfp236 C A 18: 82,674,356 E165* probably null Het
Zfp839 A T 12: 110,855,626 R291S probably damaging Het
Other mutations in Ces1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Ces1d APN 8 93195089 splice site probably benign
IGL01707:Ces1d APN 8 93189550 missense possibly damaging 0.57
IGL01753:Ces1d APN 8 93192810 missense probably damaging 1.00
IGL01918:Ces1d APN 8 93178075 missense probably benign 0.00
IGL02730:Ces1d APN 8 93186016 missense probably benign
IGL02819:Ces1d APN 8 93169718 splice site probably null
IGL02824:Ces1d APN 8 93169718 splice site probably null
IGL02825:Ces1d APN 8 93169718 splice site probably null
IGL02858:Ces1d APN 8 93169718 splice site probably null
IGL02877:Ces1d APN 8 93169718 splice site probably null
IGL02946:Ces1d APN 8 93169718 splice site probably null
IGL02990:Ces1d APN 8 93169718 splice site probably null
IGL03024:Ces1d APN 8 93169718 splice site probably null
IGL03080:Ces1d APN 8 93169718 splice site probably null
IGL03081:Ces1d APN 8 93169718 splice site probably null
IGL03082:Ces1d APN 8 93169718 splice site probably null
IGL03096:Ces1d APN 8 93178042 missense probably benign 0.01
IGL03165:Ces1d APN 8 93189519 missense probably benign 0.02
IGL03233:Ces1d APN 8 93195079 missense probably benign
IGL03263:Ces1d APN 8 93169718 splice site probably null
IGL03310:Ces1d APN 8 93175188 splice site probably benign
IGL03338:Ces1d APN 8 93169718 splice site probably null
IGL03357:Ces1d APN 8 93169718 splice site probably null
R0125:Ces1d UTSW 8 93175182 splice site probably benign
R0393:Ces1d UTSW 8 93192772 missense probably damaging 1.00
R0483:Ces1d UTSW 8 93197679 missense probably benign
R0746:Ces1d UTSW 8 93189468 missense probably damaging 1.00
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1607:Ces1d UTSW 8 93186118 missense probably benign 0.08
R1879:Ces1d UTSW 8 93189498 missense probably benign 0.35
R2881:Ces1d UTSW 8 93195031 missense probably damaging 1.00
R3870:Ces1d UTSW 8 93175086 missense probably benign 0.15
R4004:Ces1d UTSW 8 93178092 missense probably benign 0.03
R4573:Ces1d UTSW 8 93181534 missense probably benign 0.00
R4647:Ces1d UTSW 8 93166410 missense probably damaging 1.00
R4985:Ces1d UTSW 8 93175144 missense possibly damaging 0.61
R5080:Ces1d UTSW 8 93181547 missense probably benign 0.02
R5209:Ces1d UTSW 8 93175188 splice site probably benign
R5351:Ces1d UTSW 8 93178078 missense probably damaging 1.00
R5433:Ces1d UTSW 8 93186036 missense probably benign 0.02
R5614:Ces1d UTSW 8 93176204 missense probably benign 0.00
R5722:Ces1d UTSW 8 93178128 missense probably benign 0.01
R6257:Ces1d UTSW 8 93166397 missense probably benign 0.03
R7238:Ces1d UTSW 8 93178135 missense probably benign 0.01
R7410:Ces1d UTSW 8 93192805 missense probably damaging 1.00
R7489:Ces1d UTSW 8 93178131 missense probably damaging 1.00
R7563:Ces1d UTSW 8 93178039 missense probably benign 0.25
R7827:Ces1d UTSW 8 93197666 critical splice donor site probably null
R7853:Ces1d UTSW 8 93175067 missense probably benign 0.29
R7860:Ces1d UTSW 8 93171137 missense probably benign 0.08
R7936:Ces1d UTSW 8 93175067 missense probably benign 0.29
RF014:Ces1d UTSW 8 93176165 critical splice donor site probably null
Z1088:Ces1d UTSW 8 93175108 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTGGAAAGCTAACTGGG -3'
(R):5'- CCTGTTGTGAGTTATGCAAAGTTC -3'

Sequencing Primer
(F):5'- TGTACAGGTCGTCAAGCCAG -3'
(R):5'- TGCAAAGTTCTGAGGTTCCAAG -3'
Posted On2019-12-27