Incidental Mutation 'R7943:Aars'
ID612578
Institutional Source Beutler Lab
Gene Symbol Aars
Ensembl Gene ENSMUSG00000031960
Gene Namealanyl-tRNA synthetase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7943 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111033144-111057664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111049861 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 650 (K650E)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441]
Predicted Effect probably benign
Transcript: ENSMUST00000034441
AA Change: K650E

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: K650E

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,928,726 T493A probably damaging Het
Abcb1b C T 5: 8,832,258 S793F probably benign Het
Adamts18 T A 8: 113,775,276 I318F probably damaging Het
Adcy8 A G 15: 64,699,473 I1137T probably damaging Het
Ambra1 T A 2: 91,773,493 F607L probably benign Het
Ankrd46 A T 15: 36,479,420 V175D possibly damaging Het
Arhgap28 C A 17: 67,901,282 E114* probably null Het
Arrdc1 C T 2: 24,926,146 G282S probably damaging Het
Atp1a3 A T 7: 24,981,791 L790Q probably damaging Het
Bend5 T A 4: 111,415,209 V12D probably damaging Het
Bod1l C T 5: 41,819,265 E1569K probably damaging Het
Cdc123 T A 2: 5,803,964 I234L probably benign Het
Cep126 T G 9: 8,120,748 E91D probably damaging Het
Cep89 T A 7: 35,414,145 D199E possibly damaging Het
Ces1d T C 8: 93,171,137 T442A probably benign Het
Chsy3 C T 18: 59,409,227 A479V probably benign Het
Clcn4 C A 7: 7,293,061 G261C probably damaging Het
Clhc1 A T 11: 29,557,651 probably null Het
Cnot3 T A 7: 3,655,566 probably null Het
Col9a1 C A 1: 24,237,180 P723H probably damaging Het
Crybg3 A T 16: 59,555,242 M169K probably benign Het
Cxxc4 A G 3: 134,258,053 R353G probably benign Het
Dennd3 A T 15: 73,540,808 I440F probably damaging Het
Elmo3 G T 8: 105,309,017 S553I probably damaging Het
Elovl2 A G 13: 41,187,467 Y198H probably benign Het
Epm2aip1 A G 9: 111,272,037 Y26C probably damaging Het
Ext1 A C 15: 53,089,939 C510G possibly damaging Het
Extl3 A T 14: 65,077,489 D81E probably benign Het
Fbxl5 T A 5: 43,758,676 T465S probably benign Het
Gabrr2 A T 4: 33,081,470 K169* probably null Het
Gm10436 A T 12: 88,176,352 N360K possibly damaging Het
Haus4 A G 14: 54,542,145 Y341H probably damaging Het
Itgae A T 11: 73,120,273 probably null Het
Jmjd7 C T 2: 120,030,515 H149Y possibly damaging Het
Kcnh2 C T 5: 24,324,563 C725Y probably damaging Het
Mroh1 C T 15: 76,447,332 P1252L probably benign Het
Ms4a14 A G 19: 11,302,944 F750S probably benign Het
Naf1 T A 8: 66,860,513 D49E unknown Het
Notch3 T C 17: 32,122,773 T2002A possibly damaging Het
Olfr1413 G A 1: 92,574,088 D306N probably benign Het
Olfr1495 T A 19: 13,768,352 D3E probably benign Het
Olfr168 A T 16: 19,530,417 C168S probably damaging Het
Olfr301 A G 7: 86,407,911 probably benign Het
Olfr393 A T 11: 73,847,507 I206N probably benign Het
Olfr709-ps1 A T 7: 106,926,570 D296E probably benign Het
Olfr869 A T 9: 20,137,575 N153I probably benign Het
Pck1 A G 2: 173,155,950 T271A possibly damaging Het
Penk A G 4: 4,133,976 W224R possibly damaging Het
Per2 C A 1: 91,444,759 V198F probably damaging Het
Phf11d A G 14: 59,361,831 M23T probably damaging Het
Pla2g4d A G 2: 120,266,730 V796A probably benign Het
Prdx6 A T 1: 161,241,858 probably null Het
Prep A T 10: 45,091,012 N47I probably damaging Het
Prss38 G T 11: 59,375,170 H96N probably damaging Het
Rab11a C A 9: 64,728,331 E47* probably null Het
Rad18 C T 6: 112,649,837 G369D probably benign Het
Rragc T C 4: 123,929,924 V330A probably damaging Het
Serpina9 A T 12: 104,001,421 H238Q probably benign Het
Serpinb3b T A 1: 107,157,737 K91N probably damaging Het
Slc16a12 T G 19: 34,675,330 S139R probably benign Het
Slc22a27 T A 19: 7,910,107 probably null Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Slc38a9 A T 13: 112,731,614 I545F probably benign Het
Slc39a8 A T 3: 135,884,396 H349L probably damaging Het
Slk C T 19: 47,642,071 T1227I possibly damaging Het
Spdye4b A G 5: 143,194,854 E25G possibly damaging Het
St3gal1 A G 15: 67,111,265 V214A probably benign Het
St7l T A 3: 104,926,577 M550K probably benign Het
Tbk1 A C 10: 121,552,246 F638C possibly damaging Het
Tex101 A T 7: 24,669,765 C114S probably damaging Het
Ttll13 A G 7: 80,255,387 M384V probably benign Het
Ugt2b37 A T 5: 87,254,330 D147E probably damaging Het
Vmn1r10 A T 6: 57,113,701 T93S probably benign Het
Wasl G A 6: 24,619,397 P375S unknown Het
Wdr63 A G 3: 146,066,920 L457P probably damaging Het
Zfp236 C A 18: 82,674,356 E165* probably null Het
Zfp839 A T 12: 110,855,626 R291S probably damaging Het
Other mutations in Aars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars APN 8 111047972 missense possibly damaging 0.86
IGL00731:Aars APN 8 111044869 splice site probably benign
IGL00826:Aars APN 8 111040300 missense probably damaging 1.00
IGL01521:Aars APN 8 111043787 missense possibly damaging 0.85
IGL01885:Aars APN 8 111047943 missense possibly damaging 0.89
IGL01920:Aars APN 8 111043246 missense probably damaging 1.00
IGL01934:Aars APN 8 111048018 missense probably damaging 0.98
IGL02013:Aars APN 8 111047066 missense probably damaging 0.99
IGL02489:Aars APN 8 111054215 unclassified probably benign
IGL02683:Aars APN 8 111052531 unclassified probably benign
IGL03084:Aars APN 8 111041629 missense probably damaging 1.00
H8786:Aars UTSW 8 111045555 missense probably benign
R0037:Aars UTSW 8 111043259 missense possibly damaging 0.77
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0577:Aars UTSW 8 111043278 missense probably benign 0.10
R1183:Aars UTSW 8 111041574 nonsense probably null
R1642:Aars UTSW 8 111043250 missense possibly damaging 0.77
R1829:Aars UTSW 8 111042706 missense probably damaging 1.00
R1857:Aars UTSW 8 111040157 missense probably damaging 0.99
R2190:Aars UTSW 8 111040153 missense probably damaging 1.00
R2303:Aars UTSW 8 111052502 missense possibly damaging 0.84
R3918:Aars UTSW 8 111040142 missense probably damaging 1.00
R4001:Aars UTSW 8 111041602 missense probably damaging 1.00
R4434:Aars UTSW 8 111054621 missense probably null 0.74
R4909:Aars UTSW 8 111055083 missense probably damaging 1.00
R4970:Aars UTSW 8 111043679 missense probably benign 0.00
R5639:Aars UTSW 8 111043234 missense probably benign 0.01
R5991:Aars UTSW 8 111050400 missense probably damaging 1.00
R6403:Aars UTSW 8 111042249 missense possibly damaging 0.87
R6521:Aars UTSW 8 111043336 missense probably benign 0.01
R6956:Aars UTSW 8 111055130 missense probably benign 0.38
R7378:Aars UTSW 8 111042342 missense probably damaging 1.00
R7625:Aars UTSW 8 111046955 missense probably damaging 0.99
R7745:Aars UTSW 8 111041657 missense probably damaging 1.00
R7792:Aars UTSW 8 111043264 missense possibly damaging 0.75
R7860:Aars UTSW 8 111049861 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACAAAATGTTCTAGCACGTGC -3'
(R):5'- TCAGCATCTCTGTGAACGGG -3'

Sequencing Primer
(F):5'- GCTCCATAGCTTCCATCTCTG -3'
(R):5'- ATCTCTGTGAACGGGTCAGGAC -3'
Posted On2019-12-27