Mutagenetix > Incidental Mutations

Incidental Mutation 'R0688:Ganab'

61259

Institutional Source

Beutler Lab

Gene Symbol

Ganab

Ensembl Gene

ENSMUSG00000071650

Gene Name

alpha glucosidase 2 alpha neutral subunit

Synonyms

G2an, GluII

MMRRC Submission

038873-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.876) question?

Stock #

R0688 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

8898090-8916663 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8911113 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 511 (Y511N)

Ref Sequence

ENSEMBL: ENSMUSP00000093965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096246]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096246
AA Change: Y511N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: Y511N

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
low complexity region	157	169	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	275	346	3.9e-24	PFAM
Pfam:Glyco_hydro_31	387	832	8.7e-136	PFAM
low complexity region	888	898	N/A	INTRINSIC

Meta Mutation Damage Score

0.484

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad11	T	G	9: 104,124,100	V615G	probably damaging	Het
Apaf1	T	G	10: 91,061,705	E305D	possibly damaging	Het
Apol10b	A	G	15: 77,585,219	S253P	probably damaging	Het
Bbs9	T	A	9: 22,567,719	C153S	probably damaging	Het
Bicra	C	T	7: 15,989,322	G90D	probably damaging	Het
Clca4a	A	C	3: 144,961,974	L412R	probably damaging	Het
Cul3	A	T	1: 80,271,564	D597E	possibly damaging	Het
Cxcr5	A	G	9: 44,513,667		probably null	Het
Dnah10	T	C	5: 124,747,718	I646T	possibly damaging	Het
Focad	T	A	4: 88,274,213	V593D	unknown	Het
Fsip2	T	A	2: 82,982,339	S3001T	probably benign	Het
Gdf9	T	A	11: 53,436,640	L141Q	probably damaging	Het
Gm13083	T	C	4: 143,617,357	F409S	probably benign	Het
Gm4450	T	C	3: 98,456,394	E45G	probably benign	Het
Gpr180	A	G	14: 118,148,184	D136G	probably benign	Het
Itga2	G	T	13: 114,839,554	A1094E	probably benign	Het
Ly75	C	T	2: 60,316,221	A1238T	probably benign	Het
Macc1	T	C	12: 119,447,003	V502A	probably damaging	Het
Mroh4	T	C	15: 74,606,678	K923E	probably damaging	Het
Msh3	G	A	13: 92,351,431	P93S	possibly damaging	Het
Myo18a	A	G	11: 77,824,140	D474G	probably damaging	Het
Npat	T	A	9: 53,570,222	Y1077N	probably benign	Het
Olfr1214	A	T	2: 88,987,595	S202R	probably damaging	Het
Olfr427	A	C	1: 174,100,064	H202P	probably damaging	Het
Olfr52	A	T	2: 86,181,605		probably null	Het
Olfr816	T	G	10: 129,911,883	T132P	probably damaging	Het
Paqr5	T	G	9: 61,972,794	T59P	probably benign	Het
Phyhipl	C	T	10: 70,559,255	G329R	probably damaging	Het
Pomgnt1	T	C	4: 116,155,889	Y430H	probably damaging	Het
Prkd3	A	T	17: 78,957,233	M651K	probably damaging	Het
Puf60	A	T	15: 76,070,774	M440K	probably damaging	Het
Recql4	A	G	15: 76,709,809		probably null	Het
Sgk1	A	C	10: 21,998,160	M320L	probably benign	Het
Slc27a4	T	C	2: 29,812,615	F509S	probably damaging	Het
Sorbs1	T	C	19: 40,363,262	T235A	probably damaging	Het
Srrm3	A	G	5: 135,869,276		probably benign	Het
Tex15	C	T	8: 33,573,500	T986I	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Zswim4	T	C	8: 84,228,888	M301V	possibly damaging	Het

Other mutations in Ganab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Ganab	APN	19	8902595	missense	probably benign
IGL00434:Ganab	APN	19	8907343	missense	probably damaging	1.00
IGL01415:Ganab	APN	19	8914694	splice site	probably benign
IGL02418:Ganab	APN	19	8911069	missense	probably null	0.97
IGL02886:Ganab	APN	19	8911027	splice site	probably benign
IGL02997:Ganab	APN	19	8915412	missense	probably benign	0.00
IGL03108:Ganab	APN	19	8912476	missense	probably damaging	1.00
R0240:Ganab	UTSW	19	8912813	missense	possibly damaging	0.58
R0240:Ganab	UTSW	19	8912813	missense	possibly damaging	0.58
R0349:Ganab	UTSW	19	8911652	missense	probably null	0.11
R0457:Ganab	UTSW	19	8907250	missense	possibly damaging	0.92
R0551:Ganab	UTSW	19	8907280	missense	probably benign	0.35
R0645:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R0652:Ganab	UTSW	19	8915402	critical splice acceptor site	probably null
R0726:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R1427:Ganab	UTSW	19	8915666	missense	probably benign	0.00
R1946:Ganab	UTSW	19	8910808	missense	probably damaging	1.00
R1955:Ganab	UTSW	19	8911616	nonsense	probably null
R2173:Ganab	UTSW	19	8902260	unclassified	probably benign
R2280:Ganab	UTSW	19	8909468	missense	probably damaging	1.00
R2281:Ganab	UTSW	19	8909468	missense	probably damaging	1.00
R4897:Ganab	UTSW	19	8914991	missense	probably benign	0.07
R5224:Ganab	UTSW	19	8910591	missense	probably benign	0.35
R5269:Ganab	UTSW	19	8911937	missense	probably damaging	1.00
R5323:Ganab	UTSW	19	8908685	missense	probably benign	0.00
R5850:Ganab	UTSW	19	8911707	missense	probably damaging	1.00
R6469:Ganab	UTSW	19	8902632	critical splice donor site	probably null
R6911:Ganab	UTSW	19	8907788	intron	probably null
R7284:Ganab	UTSW	19	8912540	missense	probably damaging	1.00
R7412:Ganab	UTSW	19	8912528	missense	probably benign	0.01
R7413:Ganab	UTSW	19	8904975	missense	probably benign	0.01
R7466:Ganab	UTSW	19	8914569	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTGATGGCAAGCGGTACTTC -3'
(R):5'- TCAGGGTAACTAGCTGAGCCTGAG -3'

Sequencing Primer
(F):5'- AAGCGGTACTTCACTTGGGAC -3'
(R):5'- CTGAGCCTGAGAGAGAAAACACC -3'

Posted On

2013-07-30