Incidental Mutation 'R7943:Notch3'
ID612607
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7943 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32122773 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2002 (T2002A)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087723
AA Change: T2002A

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: T2002A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,928,726 T493A probably damaging Het
Aars A G 8: 111,049,861 K650E probably benign Het
Abcb1b C T 5: 8,832,258 S793F probably benign Het
Adamts18 T A 8: 113,775,276 I318F probably damaging Het
Adcy8 A G 15: 64,699,473 I1137T probably damaging Het
Ambra1 T A 2: 91,773,493 F607L probably benign Het
Ankrd46 A T 15: 36,479,420 V175D possibly damaging Het
Arhgap28 C A 17: 67,901,282 E114* probably null Het
Arrdc1 C T 2: 24,926,146 G282S probably damaging Het
Atp1a3 A T 7: 24,981,791 L790Q probably damaging Het
Bend5 T A 4: 111,415,209 V12D probably damaging Het
Bod1l C T 5: 41,819,265 E1569K probably damaging Het
Cdc123 T A 2: 5,803,964 I234L probably benign Het
Cep126 T G 9: 8,120,748 E91D probably damaging Het
Cep89 T A 7: 35,414,145 D199E possibly damaging Het
Ces1d T C 8: 93,171,137 T442A probably benign Het
Chsy3 C T 18: 59,409,227 A479V probably benign Het
Clcn4 C A 7: 7,293,061 G261C probably damaging Het
Clhc1 A T 11: 29,557,651 probably null Het
Cnot3 T A 7: 3,655,566 probably null Het
Col9a1 C A 1: 24,237,180 P723H probably damaging Het
Crybg3 A T 16: 59,555,242 M169K probably benign Het
Cxxc4 A G 3: 134,258,053 R353G probably benign Het
Dennd3 A T 15: 73,540,808 I440F probably damaging Het
Elmo3 G T 8: 105,309,017 S553I probably damaging Het
Elovl2 A G 13: 41,187,467 Y198H probably benign Het
Epm2aip1 A G 9: 111,272,037 Y26C probably damaging Het
Ext1 A C 15: 53,089,939 C510G possibly damaging Het
Extl3 A T 14: 65,077,489 D81E probably benign Het
Fbxl5 T A 5: 43,758,676 T465S probably benign Het
Gabrr2 A T 4: 33,081,470 K169* probably null Het
Gm10436 A T 12: 88,176,352 N360K possibly damaging Het
Haus4 A G 14: 54,542,145 Y341H probably damaging Het
Itgae A T 11: 73,120,273 probably null Het
Jmjd7 C T 2: 120,030,515 H149Y possibly damaging Het
Kcnh2 C T 5: 24,324,563 C725Y probably damaging Het
Mroh1 C T 15: 76,447,332 P1252L probably benign Het
Ms4a14 A G 19: 11,302,944 F750S probably benign Het
Naf1 T A 8: 66,860,513 D49E unknown Het
Olfr1413 G A 1: 92,574,088 D306N probably benign Het
Olfr1495 T A 19: 13,768,352 D3E probably benign Het
Olfr168 A T 16: 19,530,417 C168S probably damaging Het
Olfr301 A G 7: 86,407,911 probably benign Het
Olfr393 A T 11: 73,847,507 I206N probably benign Het
Olfr709-ps1 A T 7: 106,926,570 D296E probably benign Het
Olfr869 A T 9: 20,137,575 N153I probably benign Het
Pck1 A G 2: 173,155,950 T271A possibly damaging Het
Penk A G 4: 4,133,976 W224R possibly damaging Het
Per2 C A 1: 91,444,759 V198F probably damaging Het
Phf11d A G 14: 59,361,831 M23T probably damaging Het
Pla2g4d A G 2: 120,266,730 V796A probably benign Het
Prdx6 A T 1: 161,241,858 probably null Het
Prep A T 10: 45,091,012 N47I probably damaging Het
Prss38 G T 11: 59,375,170 H96N probably damaging Het
Rab11a C A 9: 64,728,331 E47* probably null Het
Rad18 C T 6: 112,649,837 G369D probably benign Het
Rragc T C 4: 123,929,924 V330A probably damaging Het
Serpina9 A T 12: 104,001,421 H238Q probably benign Het
Serpinb3b T A 1: 107,157,737 K91N probably damaging Het
Slc16a12 T G 19: 34,675,330 S139R probably benign Het
Slc22a27 T A 19: 7,910,107 probably null Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Slc38a9 A T 13: 112,731,614 I545F probably benign Het
Slc39a8 A T 3: 135,884,396 H349L probably damaging Het
Slk C T 19: 47,642,071 T1227I possibly damaging Het
Spdye4b A G 5: 143,194,854 E25G possibly damaging Het
St3gal1 A G 15: 67,111,265 V214A probably benign Het
St7l T A 3: 104,926,577 M550K probably benign Het
Tbk1 A C 10: 121,552,246 F638C possibly damaging Het
Tex101 A T 7: 24,669,765 C114S probably damaging Het
Ttll13 A G 7: 80,255,387 M384V probably benign Het
Ugt2b37 A T 5: 87,254,330 D147E probably damaging Het
Vmn1r10 A T 6: 57,113,701 T93S probably benign Het
Wasl G A 6: 24,619,397 P375S unknown Het
Wdr63 A G 3: 146,066,920 L457P probably damaging Het
Zfp236 C A 18: 82,674,356 E165* probably null Het
Zfp839 A T 12: 110,855,626 R291S probably damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8052:Notch3 UTSW 17 32146571 missense probably damaging 1.00
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTGGTCCCAGACTGCAC -3'
(R):5'- CTGGAATCCAAACTCAGGTCCATC -3'

Sequencing Primer
(F):5'- AGACTGCACCGCTTTGAG -3'
(R):5'- AAACTCAGGTCCATCTATTTCCAGGG -3'
Posted On2019-12-27