Incidental Mutation 'R7944:Sel1l3'
ID612641
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7944 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53144064 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 737 (D737G)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect probably damaging
Transcript: ENSMUST00000031090
AA Change: D737G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: D737G

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abca4 T A 3: 122,069,248 probably null Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCACATGTCAACTGTAAGATTG -3'
(R):5'- TCCCATTCCCTCAAGTGCAA -3'

Sequencing Primer
(F):5'- AGGGAAGTGCCTCTGACTC -3'
(R):5'- TCAAGTGCAAAACATTACCCAGG -3'
Posted On2019-12-27