Incidental Mutation 'R7944:Kirrel3'
ID612668
Institutional Source Beutler Lab
Gene Symbol Kirrel3
Ensembl Gene ENSMUSG00000032036
Gene Namekirre like nephrin family adhesion molecule 3
Synonyms2900036G11Rik, Neph2, 1500010O20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R7944 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location34485894-35036716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35020123 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 403 (H403Y)
Ref Sequence ENSEMBL: ENSMUSP00000140219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045091] [ENSMUST00000115148] [ENSMUST00000187182] [ENSMUST00000187625] [ENSMUST00000188658] [ENSMUST00000188933] [ENSMUST00000190549]
Predicted Effect probably benign
Transcript: ENSMUST00000045091
AA Change: H396Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048863
Gene: ENSMUSG00000032036
AA Change: H396Y

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115148
AA Change: H429Y

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110801
Gene: ENSMUSG00000032036
AA Change: H429Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 54 144 1.35e-9 SMART
IG 155 247 2.56e-1 SMART
Pfam:Ig_3 249 318 7.2e-6 PFAM
IGc2 347 405 1.66e-9 SMART
IG 425 517 1.06e-2 SMART
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 733 750 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187182
AA Change: H403Y

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140219
Gene: ENSMUSG00000032036
AA Change: H403Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 28 118 1.35e-9 SMART
IG 129 221 2.56e-1 SMART
Pfam:Ig_2 224 305 2.3e-6 PFAM
IGc2 321 379 1.66e-9 SMART
IG 399 491 1.06e-2 SMART
transmembrane domain 510 532 N/A INTRINSIC
low complexity region 612 625 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187625
AA Change: H396Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139951
Gene: ENSMUSG00000032036
AA Change: H396Y

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188658
AA Change: H44Y

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140086
Gene: ENSMUSG00000032036
AA Change: H44Y

DomainStartEndE-ValueType
Pfam:Ig_2 1 31 1.4e-1 PFAM
IG 40 132 4.5e-5 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188933
AA Change: H396Y

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139418
Gene: ENSMUSG00000032036
AA Change: H396Y

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 3.7e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 503 525 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 712 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190549
AA Change: H396Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139714
Gene: ENSMUSG00000032036
AA Change: H396Y

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 2.6e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 491 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accessory olfactory bulb formation with reduced coalescence of vomeronasal sensory neuron axons in the posterior accessory olfactory bulb, loss of male-male aggression and abnormal male sexual response to a male intruder mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abca4 T A 3: 122,069,248 probably null Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Kirrel3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Kirrel3 APN 9 35015253 critical splice acceptor site probably null
IGL01369:Kirrel3 APN 9 35016441 missense probably benign 0.07
IGL01837:Kirrel3 APN 9 35034928 missense probably damaging 1.00
IGL01950:Kirrel3 APN 9 35028329 splice site probably benign
IGL01973:Kirrel3 APN 9 35016468 missense probably damaging 1.00
IGL01994:Kirrel3 APN 9 35020133 missense possibly damaging 0.71
IGL03184:Kirrel3 APN 9 35007756 missense probably damaging 1.00
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0390:Kirrel3 UTSW 9 35020163 missense probably damaging 1.00
R0627:Kirrel3 UTSW 9 35035174 missense probably damaging 1.00
R0786:Kirrel3 UTSW 9 35034865 missense probably damaging 1.00
R0920:Kirrel3 UTSW 9 35028352 missense probably damaging 1.00
R0962:Kirrel3 UTSW 9 35000997 missense possibly damaging 0.95
R1716:Kirrel3 UTSW 9 35023547 missense probably damaging 1.00
R2010:Kirrel3 UTSW 9 34939198 missense probably damaging 1.00
R4289:Kirrel3 UTSW 9 35023473 missense probably benign 0.44
R4888:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R4970:Kirrel3 UTSW 9 34944439 missense possibly damaging 0.88
R5121:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R5368:Kirrel3 UTSW 9 35007738 missense probably damaging 1.00
R5572:Kirrel3 UTSW 9 35000948 missense probably damaging 1.00
R5707:Kirrel3 UTSW 9 35013276 missense probably damaging 1.00
R6302:Kirrel3 UTSW 9 35007749 missense probably damaging 1.00
R6449:Kirrel3 UTSW 9 34990973 missense probably benign
R6908:Kirrel3 UTSW 9 35013401 missense possibly damaging 0.86
R6967:Kirrel3 UTSW 9 35034906 missense probably damaging 1.00
R7578:Kirrel3 UTSW 9 34939112 missense probably damaging 1.00
R7861:Kirrel3 UTSW 9 35020123 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTCCCAGGAGACGTTTATGAC -3'
(R):5'- CCAAGGCTTGCACCAGTTTTG -3'

Sequencing Primer
(F):5'- CGGAATGCCTAATTTATCTTCAGGTC -3'
(R):5'- ACTCACAATTCGGTCAGG -3'
Posted On2019-12-27